We narrowed to 16,444 results for: GRN
-
Plasmid#89753PurposeU6 promoter driven expression of Cj-SgRNA cloned with BsmbIDepositorInsertCj-SgRNA
UseSgrna expression under u6 promoterPromoterU6Available SinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3045(gRNA XI-3)
Plasmid#73287PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-3DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU3m
Plasmid#66193Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU3m (SpeI site destroyed)Available SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLH-spsgRNA2
Plasmid#64114PurposeVector for expression of Sp sgRNA2 in mammalian cellsDepositorInsertSp sgRNA2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU6b
Plasmid#66196Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU6bAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPEPZ-sgRNAclone
Plasmid#141090PurposeThis vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.DepositorInsertmCherry
UseCRISPRExpressionBacterialPromoterp3Available SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX_sgRNA_entry (CJT32)
Plasmid#181782PurposeExpresses ShHELIX containing a nicking I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-TYMS_sgRNA1
Plasmid#201628PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertTYMS (TYMS Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-5sgRNA
Plasmid#64243Purposedestination vector for five U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
TP53-KO_gRNA_1
Plasmid#195130PurposeTP53-targeting gRNA in the LRG2.1 backboneDepositorInsertTP53 KO gRNA 1 (TP53 Human)
ExpressionMammalianAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC119-gRNA
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionPromoterArabidopsis U6 polymerase III promoterAvailable SinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
LentiGuidPuro-hTP53_sgRNA-1
Plasmid#88853PurposeCRISPR KO of Trp53DepositorInsertTrp53
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLH-nmsgRNA1.1
Plasmid#64115PurposeVector for expression of Nm sgRNA1.1 in mammalian cellsDepositorInsertNm sgRNA1.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pgRNAtet-lvaA
Plasmid#106397PurposeGuide RNA plasmid targeting lvaA on BBR1-UP originDepositorInsertsgRNA towards lvaA in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMarch 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgRNA 1 GAPDH
Plasmid#83808PurposeExpress Sg-1 sgRNA targeting GAPDHDepositorInsertSgRNA
UseCRISPRAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKS diaCas9_sgRNA
Plasmid#74923PurposeExpresses Cas9 codon optimized for Phaeodactylum tricornutum and a sgRNA driven by a U6 promoterDepositorInsertsLHCF2 promoter
diaCas9
LHCF1 terminator
U6 promoter
sgRNA
U6 3' region
UseCRISPRPromoterCas9 module and sgRNA moduleAvailable SinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
AV44_pCAG.Cas9-D10A.gRNA.S1
Plasmid#199258PurposeExpression construct encoding SpCas9-D10A nickase and an AAVS1-targeting guide RNADepositorInsertsSpCas9-D10A nickase
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianMutationD10APromoterCAG promoter and RNA polymerase III promoter for …Available SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGH020_sgRNA_G418-GFP
Plasmid#85405Purposehu6 driven sgRNA vector with G418 and GFP selectable markersDepositorInsertG418 resistance and GFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only