We narrowed to 9,939 results for: CAG
-
-
PXPR007 sgCIC-2
Plasmid#74959PurposeCas9 + sgCIC-2 with blasticidin selectionDepositorAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFP
Plasmid#84254PurposeExpresses optimized Sa sgCXCR4-1 gRNA with an EGFP fluorescent markerDepositorInsertSa sgCXCR4-1
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G2_Dual_sgRNA
Plasmid#173201PurposeCoselection for ABE or NHEJ in human cells. Vector for tandem expression of ATP1A1 G2 sgRNA with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATP1A1 G2 sgRNA + user-specified sgRNA
UseCRISPRExpressionMammalianPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX303 GFP-PIK3C2B
Plasmid#162001PurposeLentiviral expression vector containing PIK3C2B tagged with GFPDepositorInsertPIK3C2B (PIK3C2B Human)
UseLentiviralTagseGFPMutationsiRNA resistance to siRNA#2 with 4 silent mutatio…Available sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable sinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-5
Plasmid#118023PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PXPR007 sgCIC-1
Plasmid#74953PurposeCas9 + sgCIC-1 with blasticidin selectionDepositorAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSMP-Ehmt1_4
Plasmid#36338DepositorAvailable sinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
plentiCRISPR-v2 Puro EIF2AK2/PKR_sgRNA
Plasmid#218527PurposesgRNA targeting human EIF2AK2/PKRDepositorInsertEIF2AK2 (EIF2AK2 Human)
UseCRISPR and LentiviralAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-mCherry-SPASTIN
Plasmid#180647PurposeLentiviral expression vector for SPASTIN. Used for generating cell lines. Has N-terminal mCherry tag. SPASTIN starts on M87. Dox-inducible. Internal ID: WISP20-43.DepositorInsertSPASTIN
UseLentiviralTagsmCherryExpressionMammalianMutationStarts at M87, has siRNA resistance to GAACAGUGUG…Available sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA-puro
Plasmid#180426PurposeExpresses puromycin resistance gene and scrambled gRNA for stable integration in mammalian cells; useful as control and template for new gRNAs by mutagenesis.DepositorInsertgRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CMV-FLEX-SaCas9-U6-sgSlc6a3
Plasmid#159902PurposeMutagenesis of Slc6a3DepositorInsertSlc6a3 (Slc6a3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX458_AHR_2
Plasmid#101077PurposeEncodes gRNA for 3' target of human AHRDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against AHR (AHR Human)
UseCRISPRAvailable sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM1A_1
Plasmid#86297PurposeEncodes gRNA for 3' target of human KDM1ADepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against KDM1A (KDM1A Human)
UseCRISPRAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN3
Plasmid#52678PurposeshRNA against α-actinin-3 with eGFP transfection markerDepositorAvailable sinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
OA-1050J (GFP)
Plasmid#133304Purposeexpress arrays of gRNA targeting GFP under dU6-3 promoterDepositorInsertGFP gRNA array
ExpressionInsectPromoterU6-3Available sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAG1345 mCherry-FIREtag-DEVDG-MoA
Plasmid#205176PurposeExpresses mCherry-FIREtag-DEVDG-MoA in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmCherry-cagedFIREtag
ExpressionMammalianAvailable sinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
2xFKBP-smFP(myc)-KDEL
Plasmid#173021PurposeFKBP anchor for retaining DHFR-fused cargoes in the ER in the presence of zapalog. Encodes ER retrieval motif (KDEL) at C-terminus of spaghetti monster FP (myc, non-fluorescent). IRES following ORF.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert2xFKBP-smFP(myc)-KDEL
TagsFKBP and smFP(myc) non-fluorescentExpressionMammalianAvailable sinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGLS_2
Plasmid#163459Purposelentiviral vector expressing Cas9 and an sgRNA targeting GLSDepositorAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only
