We narrowed to 11,499 results for: aga
-
Plasmid#192184PurposeClone 16 (HH06) pFUSE-IgG1-Knob-mutation knob-clone6DepositorInsertClone 6 heavy chain (HH06)
ExpressionMammalianMutationNAAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Clone 16 - 1 HH02 pFUSE-IgG1-Hole mutation-hole-clone2
Plasmid#192183PurposeClone 16 (HH02) pFUSE-IgG1-Hole mutation-hole-clone2DepositorInsertClone 2 heavy chain (HH02)
ExpressionMammalianMutationNAAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2t-Tubulin-C-18
Plasmid#231779PurposeVisualization of tubulin in mammalian cells using mGold2tDepositorAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pCAGGS-SMS2-TEV-Twin-Strep
Plasmid#202529PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged human Sphingomyelin synthase 2 (SMS2) in mammalian cellDepositorInsertSGMS2 (SGMS2 Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted stop codon (TGA)PromoterCAG and chicken β-actin promoterAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSuper-Retro-Puro-Drp1-shRNA
Plasmid#99385PurposeExpresses shRNA against human Drp1 from puromycin resistance retroviral vectorDepositorAvailable SinceSept. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-HA-FLAG-AU1
Plasmid#162118PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to HA-FLAG-AU1
UseLentiviralTagsHA-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_OAS3
Plasmid#99324PurposeLuciferase validation vector with OAS3 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr12: 94575894 -94578286
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
SPHK2 gRNA (BRDN0001146242)
Plasmid#77095Purpose3rd generation lentiviral gRNA plasmid targeting human SPHK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLT 651
Plasmid#59998PurposeExpresses a hybrid dsRNA corresponding to the Caenorhabditis elegans klp-16/him-8 genes in bacteria; ingestion of the bacteria by C elegans produces an RNAi response & leads to more male progenyDepositorExpressionBacterialMutationpartial genomicAvailable SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
M51
Plasmid#242620PurposeStrep-MYC-His protein expression in bacteriaDepositorAvailable SinceSept. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro-Halo-hMRE11(wt)
Plasmid#208393PurposeTo generate stable cell line expressing Halo-human MRE11(WT) by Retroviral infection.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-B5.GS.CAR-3G
Plasmid#194464PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.B5 in VH-VL order & (GGGGS)3 linker (scFv). GFP-Zeo for selection & monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBW2287_pCAG-PV1-PYL-L1-FlpO-397C-NLS-BGHpA
Plasmid#108770PurposeExpresses aa397 to C-terminus of Flp recombinase fused to PYL CIDDepositorInsertFlp recombinase fragment aa397 to C-terminus
UseCre/Lox and Synthetic BiologyTagsNLS and PYLExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 mCherry-hCortKD-Flcortmut3YD
Plasmid#187266PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YD mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsmCherryMutation3YD (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 hCortKD-Flcortmut3YF mCherry
Plasmid#187265PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YF mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsmCherryMutation3YF (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV- MOG-VHVL-M26-synNotch-Gal4VP64
Plasmid#247467PurposeExpresses a synNotch binding to myelin oligodendrocyte glycoproteinDepositorInsertsynNotch receptor using a scFvs binding MOG
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SMS1-TEV-HAT
Plasmid#202557PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable HAT-tagged human Sphingomyelin synthase 1 (SMS1) in mammalian cellDepositorInsertSGMS1 (SGMS1 Human)
TagsHistidine-Affinity-tag (HAT) and TEV cleavable si…ExpressionMammalianMutationdeleted stop codon (TAA)PromoterCAG and chicken β-actin promoterAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBW2436_pCAG-PV1-GAI-L1-Cre-271C-NLS-BGHpA
Plasmid#108730PurposeExpresses aa271 to C-terminus of Cre recombinase fused to GAI CIDDepositorInsertCre recombinase fragment aa271 to C-terminus
UseCre/Lox and Synthetic BiologyTagsGAI and NLSExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only