We narrowed to 14,186 results for: shi
-
Plasmid#64144PurposeFor yeast two hybridDepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only
-
LV-CMV-Cer-FL- Bmal L95E
Plasmid#47374PurposeBmal full length with cer tag used for mutationDepositorAvailable SinceJan. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-HA/Bmal F423R/V435R/W427R
Plasmid#47351PurposePcHA-Bmal backbone used for the above mutation. Ref.Genes & Dev 17:1921-1932 2003DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN L113E
Plasmid#47356PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, L113EPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN F122D
Plasmid#47357PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, F122DPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN W284A
Plasmid#47358PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, W284APromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN V315R
Plasmid#47359PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, V315RPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC L115E
Plasmid#47377PurposeBmal fragment cloned with Venus tag used for mutationDepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN L57E
Plasmid#47354PurposeClock fragment mutatation tagged with VenNDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, L57EPromoterCMVAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-Gb2-K
Plasmid#25759PurposeEntry vector with human U6 promoter driving both mouse G alpha 12 and G alpha 13 miR30-based shRNAs.DepositorInsertGb2 miR-shRNA (Gnb2 Mouse)
UseEntry vectorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET28aAviHisCD72aCTLD
Plasmid#129065Purposegeneration of biotinylated mouse CD72a CTLD protein using bacteriaDepositorInsertCD72a (Cd72 Mouse)
ExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Rtn4a-GFP
Plasmid#61807PurposeHuman Rtn4a fluorescently tagged with GFP on the C-terminus for mammalian expressionDepositorInsertRtn4a (RTN4 Human)
TagsAcGFPExpressionMammalianMutationRtn4a Stop Codon removedPromoterCMVAvailable SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-puro-ARID1A
Plasmid#39478PurposeTetracycline-inducible lentiviral expression of human ARID1A; 3rd generation lentiviral vectorDepositorAvailable SinceSept. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-Actin
Plasmid#119870PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse Beta ActinDepositorInsertbeta Actin (Actb Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-camk2a
Plasmid#104589PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse camk2aDepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Mouse)
UseAAV, CRISPR, and Mouse TargetingPromoterNoneAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-Gnaq
Plasmid#170298PurposeEncoding mouse GnaqDepositorInsertA recombinant mouse Gnaq (Gnaq Mouse)
TagsN/AExpressionMammalianMutationAsilent mutation was introduced into the sgRNA-ta…Available SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXs-ms-Klf5
Plasmid#50787Purposeretroviral expression of mouse Klf5DepositorAvailable SinceFeb. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHR-FUSN-mCh-Cry2WT
Plasmid#101223PurposeFUS(1-214) fused to mCh-Cry2WTDepositorAvailable SinceFeb. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLSB-KAN
Plasmid#166700PurposeCombined sgRNA/Cas9 pLSB vector with kanMX6 (G418) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA Ser promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only