We narrowed to 14,369 results for: TIM
-
Plasmid#170130PurposeFor plant prime editing in wheat plants or monocotyledons protoplastsDepositorInsertnCas9-SpG(H840A)-M-MLV
UseCRISPRExpressionPlantMutationH840A, D1135L, S1136W, G1218K, E1219Q, R1335Q, T1…Promotermaize Ubiquitin-1Available SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-HF1-P2A-EGFP (RTW3505)
Plasmid#139995PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-HF1(N497A/R661A/Q695A/Q926A) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-HF1 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationHF1=N497A/R661A/Q695A/Q926APromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001148607)
Plasmid#76363Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#68717PurposeCre-dependent bicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVMutationCre-dependent expression from inverted open readi…PromoterCAG-FLEXAvailable SinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV2_CAG_oROS-HT_WPRE
Plasmid#216414PurposeEncodes the genetically encoded, chemigenetic fluorescent peroxide sensor oROS-HT in AAV viral vectorsDepositorInsertoROS-HT
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-pNFkB::Cre-mRuby3
Plasmid#164137PurposeLentiviral construct for building stable cell lines expressing Cre recombinase and mRuby3 in the presence of TNFaDepositorInsertNFkB promoter-Cre-T2A-mRuby3
UseCRISPR, Cre/Lox, Lentiviral, and Synthetic Biolog…ExpressionMammalianPromoterNFkB synthetic promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUb-Cas9-mCherry_cU6:6-sgRNA
Plasmid#190598PurposeThe plasmid encodes S. pyogenes Cas9 and mCherry separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoterDepositorInsertsCas9
sgRNA
UseCRISPRTagsmCherry - separated by T2APromoterAedes aegypti polyubiquitin and Culex quinquefasc…Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRN3P-HA-Suv4-20h1mut
Plasmid#86690PurposeFor transcription of of Suv4-20h1mut mRNA preceded by an HA-tag in 5'DepositorInserthistone-lysine N-methyltransferase KMT5B mutant (Kmt5b Mouse)
TagsHAMutationmutated region NHDC (asparagine 273 to cysteine 2…PromoterT3Available SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2A gRNA (BRDN0001149181)
Plasmid#76414Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2A gRNA (BRDN0001148547)
Plasmid#76415Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYTSK01K_0G7
Plasmid#177296Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn7 with GmRDepositorInsertPaacC1-aacC1
UseSynthetic Biology; Yeast expression, tn7 genomic …ExpressionBacterialAvailable SinceAug. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-tagBFP-hTRF2
Plasmid#103803PurposeBLInCR 'Localizer' construct that marks the telomeres and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationhTRF2: deletion of amino acids 1-42 and 476 compa…PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSH-EFIRES-P-GFP(1-10)opti
Plasmid#129416PurposeExpressing codon-optimized GFP(1-10) fragment in human cellsDepositorInsertcodon-optimized GFP(1-10)
UseCRISPR, TALEN, and Unspecified ; Human safe harbo…ExpressionMammalianPromoterEF-1αAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#68720PurposeCre-dependent bicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVMutationCre-dependent expression from inverted open readi…PromoterhSyn1-FLEXAvailable SinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKD1 gRNA (BRDN0001149263)
Plasmid#76843Purpose3rd generation lentiviral gRNA plasmid targeting human PKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc LbaCas12a
Plasmid#182125PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc LbaCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc LbaCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
PRKCE gRNA (BRDN0001148049)
Plasmid#76791Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only