We narrowed to 9,967 results for: crispr plasmids
-
Plasmid#127566PurposeCRISPaint universal donor plasmid for gene exon insertion. Encodes sfGFP-SV40 and 3xP3-RFP visible eye marker.DepositorInsertsfGFP
UseCRISPRExpressionInsectAvailable SinceJuly 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hCDCP1-gRNA3
Plasmid#249218PurposeCDCP1 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hCDCP1-gRNA2
Plasmid#249217PurposeCDCP1 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hCDCP1-gRNA1
Plasmid#249216PurposeCDCP1 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hPTK7-gRNA3
Plasmid#249209PurposePTK7 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hPTK7-gRNA2
Plasmid#249208PurposePTK7 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hPTK7-gRNA1
Plasmid#249207PurposePTK7 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEARBOCS-v0
Plasmid#196495PurposeCRISPR tool to target astrocytesDepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLinker-6xHA-HXGPRT-LoxP
Plasmid#86552PurposeThe plasmid is used for endogenous tagging using CRISPR technology in ToxoplasmaDepositorInsertLinker-6xHA-HGPRT-LoxP
UseExpression in toxoplasma gondiiAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-eGFP
Plasmid#99375PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A eGFP from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-eGFP
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti MS2-P65-HSF1_Hygro
Plasmid#61426Purposelenti vector encoding the MS2-P65-HSF1 activator helper complex with a 2A Hygro resistance marker NOTE: A version of this plasmid with improved titer is available: Addgene plasmid #89308 lentiMPH v2DepositorInsertMS2-P65-HSF1_2A_Hygro (HSF1 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianMutationN55K in MS2PromoterEF1AAvailable SinceDec. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNA
Plasmid#61593PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTagsHA, NLS, and OLLAS tagExpressionMammalianMutationK175R and K736R (deUb mutations)Available SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-mTagBFP2
Plasmid#99374PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A mTagBFP2 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-dTomato
Plasmid#99376PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A dTomato from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-dTomato
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
H517 SONIC HRASV12 donor
Plasmid#138177PurposeCRISPR SONIC: HRAS G12V donor plasmidDepositorInsertHRASV12 (HRAS Human)
UseNhej donorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGLOW39
Plasmid#173068PurposemScarlet^SEC^3xMyc vector with ccdB sites for cloning homology armsDepositorInsertmScarlet-I-C1^SEC^3xMyc
UseCRISPR and Cre/LoxTags3xMyc and C. elegans codon-optimized mScarletExpressionWormAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Olig2 x2)
Plasmid#171101PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Olig2.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
H516 SONIC KrasG12D-IRES-luciferase donor
Plasmid#138178PurposeCRISPR SONIC: Kras G12D luciferase donor plasmid.DepositorInsertKrasG12D (Kras Mouse)
UseNhej donorAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hMbCas12a-NLS(nucleoplasmin)-3xHA (AAS2134)
Plasmid#114090PurposeCAG promoter expression plasmid for human codon optimized MbCas12a nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized MbCas12a
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only