We narrowed to 6,928 results for: tac
-
Plasmid#80174Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng2.b-AP-His
Plasmid#71995PurposeExpresses the extracellular region of the Netrin G2, isoform b protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lox-stop-Lox p53 R270H
Plasmid#14853DepositorInsertp53 R270H (Trp53 Mouse)
UseCre/LoxTagsLox-STOP-loxExpressionMammalianMutationContact mutant R270H. (Murine p53 codon 270 corre…Available SinceApril 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
PFKFB4 gRNA (BRDN0001149495)
Plasmid#77123Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB4DepositorAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.a-AP-His
Plasmid#71984PurposeExpresses the extracellular region of the Netrin G1, isoform a protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK17A gRNA (BRDN0001149480)
Plasmid#77916Purpose3rd generation lentiviral gRNA plasmid targeting human STK17ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK17B gRNA (BRDN0001146764)
Plasmid#76798Purpose3rd generation lentiviral gRNA plasmid targeting human STK17BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Ago2_1
Plasmid#73529PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Ago2DepositorInsertAGO2
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-shKcnk13
Plasmid#120721PurposeExpresses GFP and an shRNA targeting Kcnk13 (in pLL3.7)DepositorInsertKcnk13 (Kcnk13 Mouse)
UseLentiviral and RNAiTagsGFPExpressionMammalianPromotermouse U6Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPN063
Plasmid#91596PurposeExpress sgRNA targeting human DFNA5DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Ehmt1_2
Plasmid#36336DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCI-Flag-NEDD4L∆WW1,2,4
Plasmid#171137Purposeexpresses NEDD4L with inactivating mutation in first, second and fourth WW domain, but intact third WW domain, in mammalian cellsDepositorInsertNEDD4L (NEDD4L Human)
TagsFLAGExpressionMammalianMutationchanged tryptophan 221 to alanine, tryptophan 453…Available SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pX459-HypaCas9-ECT2_sgRNA
Plasmid#183873PurposepX459V2.0-HypaCas9 plasmid with ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000072225
Plasmid#78160PurposeshLacZ controlDepositorInsertLacZ
UseLentiviral and RNAiPromoterhU6 and hU6Available SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMETAP1_2
Plasmid#163463Purposelentiviral vector expressing Cas9 and an sgRNA targeting METAP1DepositorInsertsgRNA 2 targeting METAP1 (METAP1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-MS2
Plasmid#184839PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
OR6K6_Deletion_gRNA2
Plasmid#195196Purposedual gRNAs for deletion of OR6K6 in a third generation Cas9 backbone with GFPDepositorInsertOR6K6 dual gRNA (OR6K6 Human)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
OR6K6_Deletion_gRNA1
Plasmid#195195Purposedual gRNAs for deletion of OR6K6 in a third generation Cas9 backbone with GFPDepositorInsertOR6K6 dual gRNA (OR6K6 Human)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only