We narrowed to 8,284 results for: crispr grnas
-
Plasmid#88849PurposeCRISPR KO of Trp63DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pLentiCRISPRv2_IFNB1_gRNA_1
Plasmid#235532PurposegRNA against human IFNB1DepositorInsertIFNB1 (IFNB1 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_IFNB1_gRNA_3
Plasmid#235533PurposegRNA against human IFNB1DepositorInsertIFNB1 (IFNB1 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MDM4_CRISPRi_gRNA_2
Plasmid#195133PurposegRNA from the Weissman CRISPRi library targeting MDM4, cloned into a third generation gRNA backbone with mCherryDepositorInsertMDM4 CRISPRi gRNA 2 (MDM4 Human)
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDM4_CRISPRi_gRNA_1
Plasmid#195132PurposegRNA from the Weissman CRISPRi library targeting MDM4, cloned into a third generation gRNA backbone with mCherryDepositorInsertMDM4 CRISPRi gRNA 1 (MDM4 Human)
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DPB
Plasmid#164989PurposeExpression of gRNA targeting HLA-DPB locus, including DPB1*01:01:01DepositorInsertgRNA against HLA-DPB1*01:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DQB
Plasmid#164991PurposeExpression of gRNA targeting HLA-DQB locus, including DQB1*05:01:01DepositorInsertgRNA against HLA-DQB1*05:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DRB
Plasmid#164992PurposeExpression of gRNA targeting HLA-DRB locus, including DRB1*01:02:01DepositorInsertgRNA against HLA-DRB1*01:02:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DQA
Plasmid#164990PurposeExpression of gRNA targeting HLA-DQA locus, including DQA1*01:01:01DepositorInsertgRNA against HLA-DQA1*01:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DPA
Plasmid#164988PurposeExpression of gRNA targeting HLA-DPA locus, including DPA1*02:01:08DepositorInsertgRNA against HLA-DPA1*02:01:08
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB3053(gRNA X-2, XI-5, XII-4)
Plasmid#73295PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-2, XI-5, and XII-4DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141A
Plasmid#69290PurposeGateway entry vector; single gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-4sgRNA
Plasmid#64242Purposedestination vector for four U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgAMPKa1
Plasmid#138684PurposeExpresses a human AMPKa1-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.1
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA2
Plasmid#99735PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPN158
Plasmid#91687PurposeExpress sgRNA targeting human ZSWIM6DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN159
Plasmid#91688PurposeExpress sgRNA targeting human ZSWIM6DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only