We narrowed to 6,127 results for: tTA
-
Plasmid#232016PurposeExpression of the CHMP2B VPS4-binding region attached to sfGFP.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only
-
TRE3G-PE2-P2A-BFP
Plasmid#231580PurposeExpresses the PE2 prime-editing machinery fused to BFP (PE2-P2A-BFP), under the control of a TRE3G promoter. This promoter is responsive to doxycycline bound to the rtTA proteinDepositorInsertPE2-P2A-BFP
UseLentiviralTagsP2A-BFPExpressionMammalianPromoterTRE3GAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
PEmax_AAVS1_knockin_HDR_donor
Plasmid#223000PurposeHDR donor plasmid for PEmax knockin at AAVS1 locus. Left_homology_arm-splicing_acceptor-T2A-NeoR-bGHpA-pEF1α-PEmax-IRES2-EGFP-WPRE-βglobinpA-right_homology_armDepositorInsertPEmax
UseHdr donorTagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterEF1αAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-Osp.gRNA-MS2in
Plasmid#229772PurposeContains the U6 promoter and an optimized gRNA backbone inserted with two copies of the MS2 stem loop.DepositorInsertgRNA cassette with two MS2 stem loops
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA3_NIPBL_Cas9-hGem-for_N-terminal_tagging
Plasmid#217662Purposeexpresses Cas9-hGem and guideRNA for N terminal tagging of NIPBLDepositorInsertsgRNA3 for N terminal tagging of NIPBL (NIPBL Human)
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-NLS-actin-R62D
Plasmid#118381PurposeGateway compatible donor vector with nuclear localization signal (NLS) attached to actin-R62D.DepositorAvailable SinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLIX403_RPS2_APOBEC_HA_P2A_mRuby_Capture1
Plasmid#194703PurposeInducible lentiviral expression, TRE-RPS2-APOBEC-HA-P2A-mRuby; PGK-puro-2A-rtTA (Ribo-STAMP, RPS2)DepositorInsertRPS2 (RPS2 Human)
UseLentiviralTagsAPOBEC1-HA-P2A-mRubyExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR10
Plasmid#167003PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDK2 gRNA (BRDN0001147786)
Plasmid#77192Purpose3rd generation lentiviral gRNA plasmid targeting human CDK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKIF1C-GFP
Plasmid#130977PurposeExpression of KIF1C-GFP in mammalian cells.DepositorInsertKIF1C-GFP (KIF1C Human)
TagsGFPExpressionMammalianMutation5 silent mutations that make this construct RNAi …PromoterCMVAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
TriEx-4 DHX36
Plasmid#68368PurposeExpresses the N-terminal histidine-tagged DXH36 gene product upon transfection into Rosetta 2 E. coli and induction with IPTG.DepositorInsertDHX36 (DHX36 Human)
TagsHistidineExpressionBacterial, Insect, and Mamm…PromoterCMV ie enhancer/promoterAvailable SinceSept. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-STING-sh5
Plasmid#127647PurposeKnock-down of human STINGDepositorInsertSTING shRNA (STING1 Human)
UseLentiviralAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 LIPT1-1
Plasmid#184480PurposeLentivirus gRNA targeting human LIPT1 geneDepositorInsertLIPT1 (LIPT1 Human)
UseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
shYAP1 # 2
Plasmid#42541DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTER RB1shRNA human
Plasmid#66886PurposeDoxycycline-regulated mammalian expression vector for expressing shRNA against RB1DepositorAvailable SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 2 tet pLKO puro
Plasmid#162984PurposeTet-inducible shRNA targeting human METTL3 #2DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-SOX4
Plasmid#185552PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting SOX4DepositorInsertSOX4 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSLC7A11/xCT-2
Plasmid#161819Purposeknock out SLC7A11/xCT in mammalian cellsDepositorInsertsolute carrier family 7 member 11 (SLC7A11 Human)
UseCRISPR and LentiviralAvailable SinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB-Halo,IRES-eGFP
Plasmid#164519PurposeAll-in-One piggyBac transposon Gateway Destination vector for dox-inducible expression of N-terminal Halo tagged protein (inducible GFP and constitutive rtTA and neomycin resistance)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only