We narrowed to 8,446 results for: gnal
-
Plasmid#211364PurposeLentiviral expression vector for an insert of interest linked to a P2A-T2A puromycin sequence. Produces virus very efficiently. Can also be used for regular transfectionsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pGS-FCER1G-1
Plasmid#109192PurposeEncodes human full-length FCER1G to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli3/Flag P1-6A
Plasmid#51248PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 849,865,877,907,980,1006 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 849,865,877,907,980,1006 mutated to A…PromoterEF1aAvailable SinceMarch 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBa-LSS-GFP-LDLR wt
Plasmid#98184PurposeLow Density Lipoprotein Receptor N-terminally tagged with Green Fluorescent Protein. LSS= LDLR signal sequence, which is cleaved leaving the GFP attached to the mature LDLR protien.DepositorInsertLDLR (LDLR Human)
TagsGFP and LDLR signal sequence, N-term of GFP so GF…ExpressionMammalianMutationnonePromoterChicken Beta ActinAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-UbC-Blast-2A-STING-mNeonGreen
Plasmid#227185PurposeLentiviral expression plasmid encoding STING-mNeonGreen under UbC promoterDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXs-IP-mVenus-TOSI
Plasmid#172491PurposemVenus-TOSI (TOr-Signal-Indicator) is a fluorescent reporter for mTORC1 signaling (monitoring PDCD4 degradation) which can be introduced to mammalian cells by retrovirus vector.DepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXs-IP-mCherry-TOSI
Plasmid#172496PurposemCherry-TOSI (TOr-Signal-Indicator) is a fluorescent reporter for mTORC1 signaling (monitoring PDCD4 degradation) which can be introduced to mammalian cells by retrovirus vector.DepositorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N3-EPAC1
Plasmid#113110PurposeHuman EPAC1 gene was fused in-frame and upstream from the enhanced YFP gene in pEYFP-N3 vector (Clonetech).DepositorAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
APOE_pLX307
Plasmid#98317PurposeLentiviral expression of APOEDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
BRAF_pLX307
Plasmid#98322PurposeLentiviral expression of BRAFDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-FLAG-KORD-P2A-ArgiNLS-AausFP1
Plasmid#220612PurposeCre-dependent co-expression of FLAG-tagged inhibitory KORD DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporter.DepositorInsertFLAG-KORD-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-FLAG-KORD-P2A-3xHA-hM3D(Gq)
Plasmid#220611PurposeNeuron-specific, Cre-dependent co-expression of FLAG-tagged inhibitory KORD DREADD receptor, and 3x HA-tagged excitatory hM3D(Gq) DREADD receptor.DepositorInsertFLAG-KORD-P2A-3x HA-hM3D(Gq)
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterhSynAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
IGF1R_pLX307
Plasmid#98344PurposeLentiviral expression of IGF1RDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-N-3XFLAG-Gsk3b
Plasmid#123592DepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-hPGK-Blast-2A-STING-TurboID
Plasmid#204713PurposeExpresses C-terminal TurboID tagged human STING for proximity ligation.DepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIGAhRC
Plasmid#112510Purposehuman Ah receptor and Arnt cDNAs expressed under control of Gal1,10 bidirectional promoterDepositorUseSynthetic BiologyExpressionYeastPromoterGal1,10Available SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-EF1α-mKate2-PDE4D3-Cat
Plasmid#169128PurposeAAV plasmid containing a mKate2 and a truncated PDE4D3DepositorHas ServiceAAV1InsertmKate2-PDE4DCatL (PDE4D Human)
UseAAV and Cre/LoxTagsmKate2ExpressionMammalianMutationtruncated, Catalatic domain onlyPromoterEF1aAvailable SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
GCH1_pLX307
Plasmid#98336PurposeLentiviral expression of GCH1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only