We narrowed to 14,497 results for: SHR
-
Plasmid#102908PurposePiggyBac transposon system construct for U6 promoter-driven expression of a gRNA targeting EEA-motif. Includes PGK-puro selection cassette.DepositorInsertEEA-guide1-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR: pmU6 sgChr3q29 2xMS2 pUbC MCP-mCherry-p2a-Puro
Plasmid#174118PurposeExpression of sgRNA targeting Chr3q29 (chr3: 195478317 - 195506985, hg38)DepositorInsertsgChr3q29 2xMS2 and MCP-mCherry-p2a-Puro
UseLentiviralPromotermU6 and UbCAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgAAVS1
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDD428
Plasmid#202081PurposeCas9/sgRNA plasmid targeting the C-terminus of Myh9DepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFTK093
Plasmid#171365PurposeVector part (LVL1) from the Fungal Modular Cloning ToolKit.DepositorInsertsgRNA transcription unit (MoClo lvl1 unit), P-gpdA-HH-sgRNA-HDV-Ttrpc, replacable LacZ gene
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
P23_vanR_Ptec_mCherry
Plasmid#248114PurposeVanillate switch driving mCherry expressionDepositorInsertsmCherry red fluorescent protein
VanR repressor
ExpressionBacterialPromoterP23 and Ptec flanked by vanO operatorsAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-u6-gRNA(deltaD1)-hSyn-mCherry
Plasmid#231400PurposeKnockdown of DRD1 across rodent speciesDepositorInsertsgRNA(DRD1.2)
UseAAV and CRISPRExpressionMammalianPromoteru6Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGuide
Plasmid#64711PurposeCloning and expression of Streptococcus pyogenes guide RNADepositorInsertStreptococcus pyogenes guide RNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCP-tRNA
Plasmid#133812PurposeCRISPR-Cas9 system for genetic manipulation of Candida parapsilosis, C. orthopsilosis, and C. metapsilosisDepositorInsertcassette for the expression of the sgRNA from the C. parapsilosis RNA pol II GAPDH promoter
UseCRISPRAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
7a sgRNA for EJ7-GFP and 4-μHOM reporters
Plasmid#113620PurposesgRNA/CAS9 expression plasmid to induce the 5’ double-strand break in both the EJ7-GFP and 4-μHOM reportersDepositorInsert7a sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
7b sgRNA for EJ7-GFP reporter
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_TRAC
Plasmid#164993PurposeExpression of gRNA targeting TCRalpha constant locusDepositorInsertgRNA against TRAC
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgCtr- LentiCRISPRv2
Plasmid#107402PurposeLentiviral expression of Cas9 and a control gRNADepositorInsertcontrol gRNA
UseLentiviralAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
SGEP
Plasmid#111170PurposemiR-E (miR-30 variant)-based RNAiDepositorInsertmiR-E (miR-30 variant)
UseLentiviralMutationWTPromoterSFFVAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pB025
Plasmid#183092PurposeExpresses FnCas12a in Bacteroides and used for genome editingDepositorInsertFnCas12a, gRNA, Promoter, HAB, TetR,
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1TDPGH023Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB_mU6_enh-gRNA_Puro-T2A-BFP
Plasmid#235571PurposeEnhanced guide RNA expression & genomic integration. Target gRNA sequences are cloned in via the BstXI and BlpI sites.DepositorInsertsgRNA backbone
UseCRISPRAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgControl
Plasmid#230080PurposeCrispr knock out controlDepositorInsertnon-specific sequence control
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVUT-tTR-KRAB
Plasmid#11651PurposeTet-regulated (Tet-on) lentiviral vector for transgene (hUbiquitin promoter) - AND/OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 3rd generationDepositorHas ServiceCloning Grade DNAInserthUbiquitin C, GFP, tTR-KRAB, Tet-on
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
p426-SNR52p-gRNA.csr-1.Y-SUP4t
Plasmid#68060PurposegRNA for csr-1 locus in N. crassaDepositorInsertgRNA for csr-1 locus
UseCRISPR; N. crassa, fungiExpressionYeastPromoterSNR52Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only