We narrowed to 19,813 results for: INO
-
Plasmid#222877PurposeRetroviral vector encoding positive control receptor chain for BRET signal. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, full Nanoluciferase, RH linker, CyOFP1.DepositorInsertFRB-GPA-NanoLuc-CyOFP1
UseRetroviralTagsMycExpressionMammalianPromoterMSCV LTRAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SNX10-PX (1-201)
Plasmid#119091PurposeBacterial expression of human phox homology (PX) domain, SNX10-PX (1-201)DepositorAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
p-EGFP-C1-Flag-mFmr1(A)
Plasmid#87913PurposeExpresses mouse FMRP-EGFP fusion with S499A to prevent phosphorylation.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMA3383
Plasmid#46875PurposeA retroviral vector for the constitutive expression of soluble guanylate cyclase1 beta3DepositorAvailable SinceAug. 13, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
LITE2.0 EF1a_NLS(alpha-imp)-CRY2PHR-NLS-VP64_2A_GFP_WPRE_hGHpA
Plasmid#47457PurposeLITE2.0 CRY2PHR-VP64. Changes from LITE1.0: N-terminal alpha-importin nuclear localization sequence. EF1-alpha promoter for ubiquitous mammalian expression.DepositorInsertNLS(alpha-imp)-CRY2PHR-NLS-VP64
Tags2A_GFPExpressionMammalianPromoterEF1-alphaAvailable SinceOct. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
His-MBP-NRBF2
Plasmid#99330PurposeMammalian expression of NRBF2, which associates with the PI3KC3-C1 complexDepositorInsertNuclear receptor-binding factor 2 (NRBF2 Human)
TagsHis-MBPExpressionBacterialPromoterT7Available SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
882 pSG5L HA PTEN G129E
Plasmid#10746DepositorAvailable SinceSept. 27, 2005AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
L2125-FRB-GPA-NLuc-CyOFP1
Plasmid#222885PurposePositive control receptor chain for BRET signal. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, full Nanoluciferase, 10 GS linker, CyOFP1.DepositorInsertFRB-GPA-20GS-NanoLuc-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-cGAS-N-HA
Plasmid#130913PurposeExpresses human cGAS N terminus(aa1-159)-HA; Puromycin selection markerDepositorInsertcGAS N terminus
TagsHAExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
p-EGFP-C1-Flag-mFmr1(D)
Plasmid#87914PurposeExpresses mouse FMRP-EGFP fusion with phosphorylation mimic S499D.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21 Catalytic Domain of MALT1
Plasmid#48970PurposeExpresses catalytic domain of MALT1 in e.coli AA 329-566DepositorAvailable SinceOct. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
GST-Delta23C11orf83
Plasmid#65849Purposebacterial expression of GST (N-ter) - Delta 23 C11orf83/UQCC3 (UQCC3 protein depleted of its N-terminal transmembrane domain)DepositorInsertUQCC3 depleted of its N terminal transmembrane part (UQCC3 Human)
TagsGSTExpressionBacterialMutationdeletion of the 23 first aa (TM)Available SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV2_hSyn_NES-Caprola_06-mEGFP_WRPE-SV40
Plasmid#194690PurposehSyn1 driven expression of the calcium recorder Caprola_06 fused to mEGFP for neuronal expression through AAV transductionDepositorInsertCaprola_06-mEGFP
UseAAVTagsmEGFPPromoterhSyn1Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-BECN1
Plasmid#99328PurposeComponent for mammalian expression of recombinant PI3KC3-C1 complexDepositorAvailable SinceAug. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDule-Mb haloTyrRS C6
Plasmid#160377PurposeC6 HaloTyrosine tRNA synthatase and cognate amber suppressing tRNA derived from M. barkeri.DepositorInsertC6 HaloTyrosine tRNA synthatase
UseSynthetic BiologyExpressionBacterial and MammalianMutationL270S, Y271L, N311G, C313TAvailable SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRSETb-pcDronpa2-A69T
Plasmid#98578Purposephotoconvertible fluorescent protein pcDronpa2-A69T in pRSetB plasmid, photoconvertible by primed conversion mechanism, bacterial overexpressionDepositorInsertpcDronpa2-A69T
Tags6xHisExpressionBacterialPromoterT7Available SinceMarch 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMA3379
Plasmid#46874PurposeA lentiviral vector for the doxycycline-inducible expression of soluble guanylate cyclase1 alpha3DepositorAvailable SinceDec. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDGB1alpha11_SulR
Plasmid#186424Purposetranscriptional unit for sulfadiazine resistance; plant expression driven by the Pnos promoter; suitable for quintuple assemblyDepositorInsertSulR
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTV-Pou5f1g5prime-1000-24MS96T-3F_NeoR
Plasmid#174883PurposeTargeting vector for generating Pou5f1 STREAMING-tag KI cellDepositorInsertSTREAMING-tag with homology arms for Pou5f1
UseMouse TargetingAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only