We narrowed to 11,832 results for: NSI;
-
-
pF713-pEGFP-N1-Hs-FL-METTL20 wt
Plasmid#85114Purposetransfection of HeLa cell for transient expression of human full-length METTL20-EGFP fusionDepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNL2119 pARF7 GG0-GG1
Plasmid#195910PurposeLevel 0 pARF7 promoter with GG0 and GG1 golden gate linkersDepositorInsertpARF7 (NPH4 Mustard Weed)
UseSynthetic BiologyAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOUPc-UL148-HA
Plasmid#179343PurposeAll-in-one "tet-on" 3G lentiviral vector plasmid encoding human cytomegalovirus UL148 ER resident glycoprotein with a C-terminal HA tag fused to its cytoplasmic tailDepositorInserthuman cytomegalovirus UL148 fused to HA epitope
UseLentiviral and Synthetic Biology; Hiv-1 based rep…TagsHA tagExpressionMammalianMutationinsert matches UL148 from strain TB40/EPromoterTet responsive element 3GAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ cMyc-oDam_f_GFPoNLS
Plasmid#85818PurposeiDamID plasmid. To express transiently the c-Myc-tagged and optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertcMyc oDam_f_GFPoNLS
TagscMyc and oNLS (optimized nuclear localization sig…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-B2UP49_GFP
Plasmid#103071PurposeCas9 coding gene template with optimized sequence for human codon usage, also expresses EGFPDepositorInsertB2UP49(Cas9 coding gene from Akkermansia muciniphila (strain ATCC BAA-835))
UseCRISPRExpressionMammalianMutationhuman codon-optimizedPromoterCMVAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMMP-NGFR:LMP1-IRES-mRFP
Plasmid#36974DepositorUseRetroviralExpressionMammalianMutationNGFR:LMP1 chimeric receptor consists of aa 1–276 …PromoterCMVAvailable SinceAug. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV8-hSyn-flex-miR30-eGFP-shNts
Plasmid#132717PurposeEncodes Cre-dependent short hairpin RNA (shRNA) that targets the 3’-untranslated region of the rat Nts gene which encodes neurotensinDepositorAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
MO70-N-Flag-hCRACR2A-isoform-a-Q604L
Plasmid#79595PurposeTransient and retroviral expressionDepositorInsertCRACR2A-isoform-a (CRACR2A Human)
UseRetroviralTagsFLAGExpressionMammalianMutationQ604LPromoterCMVAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
MO70-N-Flag-hCRACR2A-isoform-a-T559N
Plasmid#79594PurposeTransient and retroviral expressionDepositorInsertCRACR2A-isoform-a (CRACR2A Human)
UseRetroviralTagsFLAGExpressionMammalianMutationT559NPromoterCMVAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A LaG17-SynNotch 204TAG 442TAA
Plasmid#154779Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and LaG17-SynNotch 204TAG 277TAA, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertLaG17-SynNotch
TagsLaG17ExpressionMammalianMutation204TAG 442TAA in LaG17-SynNotch, hybrid PylT with…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/Puro/FA/GFP-C--Catulin-4
Plasmid#112844Purposetransient/stable overexpression of the N-terminal and central domains of Catulin.DepositorInsertCatulin-alpha-1 (Ctnnal1 Mouse)
TagsGFPExpressionMammalianMutationN + C1 domains of CatulinAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSIIneo-TRE-hPhyB621- mCherry-HRasCT
Plasmid#139482PurposeExpresses PhyB621-mCherry-HRasCT in mammalian cells.DepositorInsertPhyB621 (PHYB Mustard Weed)
UseLentiviralTagsmCherry-HRasCTExpressionMammalianMutationG229L and deletion of aa Y at position 235 in mch…PromoterTet responsible elementAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/Puro/FA/GFP-C--Catulin-2
Plasmid#112842Purposetransient/stable overexpression of the central domain of Catulin.DepositorAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Gpr45-S214P-3xFlag
Plasmid#245987PurposeExpress 3xFlag C-terminal tagged mouse GPR45-S214P mutant transiently via transfection in mammalian cells.DepositorAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBOB-Gpr161-3xFlag
Plasmid#245992PurposeExpress 3xFlag C-terminal tagged mouse GPR161 transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOB-Gpr45-Y287C-3xFlag
Plasmid#245977PurposeExpress 3xFlag C-terminal tagged mouse GPR45-Y287C mutant transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorInsertGpr45 (Gpr45 Mouse)
UseLentiviralTags3xFlagExpressionMammalianMutationY287CPromoterCMVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOB-Gpr45-S214P-3xFlag
Plasmid#245978PurposeExpress 3xFlag C-terminal tagged mouse GPR45-S214P mutant transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorInsertGpr45 (Gpr45 Mouse)
UseLentiviralTags3xFlagExpressionMammalianMutationS214PPromoterCMVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Gpr45-Y287C-3xFlag
Plasmid#245986PurposeExpress 3xFlag C-terminal tagged mouse GPR45-Y287C mutant transiently via transfection in mammalian cells.DepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOB-HA-Gnal
Plasmid#245995PurposeExpress HA N-terminal tagged mouse Galphaolf transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOB-Gpr45-3xFlag
Plasmid#245976PurposeExpress 3xFlag C-terminal tagged wild-type mouse GPR45 transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_FOidr_131
Plasmid#244683PurposeExpress mEGFP-tagged intrinsically disordered protein (IDR), FOidr_131, derived from human fusion protein PAX5_BZW1; PAX5_CBFA2T3; PAX5_ESRRA; PAX5_FOXP1; PAX5_JAK2; PAX5_KANK1; PAX5_NCOA5; PAX5_NOL4L; PAX5_PAX5; PAX5_ZCCHC7; PAX5_ZNF276; PAX5_ZNF521; ZCCHC7_PAX5DepositorInsertFOidr_131
Tagsmonomeric EGFPExpressionMammalianMutationUnmutatedAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACT-HAB1
Plasmid#241276PurposeYeast two hybrid vector expressing AD-HAB1DepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5R 15xGly-uFMR1-3xHA
Plasmid#242191PurposeTransient expression of 15xGly-uFMR1-3xHADepositorAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW27K_7Ti1
Plasmid#177294Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcR and LacZDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWB515_35S-HA-(ΔTP)DM3(Col-0) D332A Q345A N349A
Plasmid#229716PurposeStable transformation or transient expression of gene of interest in plantsDepositorInsertDM3(Col-0) (AT3G61540 Mustard Weed)
ExpressionPlantMutationamino acid 1-52 were deleted, D332A Q345A N349AAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 2xFLAG-2xSTREP-KEAP1 (human)
Plasmid#236422Purposetransient overexpression of KEAP1 in mammalian cellsDepositorInsertKEAP1 (KEAP1 Human)
ExpressionMammalianAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFPc1 QFR IP3R3
Plasmid#236454Purposetransient overexpression of IP3R3 in mammalian cellsDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFPc1 K-RAS 4A
Plasmid#236451Purposetransient overexpression of K-RAS 4A in mammalian cellsDepositorInsertK-RAS 4A (KRAS Human)
ExpressionMammalianAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 FLAG Fbxw7gamma
Plasmid#236471Purposetransient overexpression of FBXW7gamma in mammalian cellsDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Step-FLAG FBXO21
Plasmid#236458Purposetransient overexpression of FBXO21 in mammalian cellsDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Strep-FLAG KBP
Plasmid#236459Purposetransient overexpression of KBP in mammalian cellsDepositorAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX.(Cyto)iGlucoSnFR.H66A.L276V-mRuby2
Plasmid#238943PurposeGreen glucose sensor with mRuby2 fusion, high sensitivity, cytosolicDepositorInsertiGlucoSnFR.L276V.K312A
UseLentiviralTagsMyc-mRuby2ExpressionMammalianPromoterCMVAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcs2-Δhel1/Δhel2HRI-GFP-IRES-mCherry
Plasmid#226101PurposeHRI stability reporter construct with deletion of SIFI degron helices 1&2 for transient expression in mammalian cellsDepositorInsertHRI (EIF2AK1 Human)
TagsGFPExpressionMammalianMutationSIFI degron helices 1 & 2 deleted (Δ61-112)Available SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcs2-N-HRI(1-138)-GFP-IRES-mCherry
Plasmid#226100PurposeHRI N-terminal region (residues 1-138) stability reporter construct for transient expression in mammalian cellsDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VcnTS-E1015A-E1021A
Plasmid#213411PurposeVinculin tension sensor (VcnTS) with both directionally asymmetric, force strengthening (DAFS) variant point mutations (E1015A and E1021A), in lentiviral expression vector.DepositorInsertVcnTS-E1015A-E1021A (VCL Synthetic, Chicken)
UseLentiviralMutationMutated vinculin glutamic acid 1015 and 1021 to a…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Parkin(C431N)-A92mKO2
Plasmid#213545PurposeTransient mammalian expresssion of ligase-dead C431N Parkin, internally tagged with mKO2DepositorAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1TMSNKRS
Plasmid#198323PurposetRNA synthetase/tRNA pair for the in vivo incorporation of N6-(((trimethylsilyl)methyl)carbamoyl)-L-lysine (TMSNK), into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_FLAG-NFL(K363TAG)
Plasmid#182661PurposeExpresses mouse neurofilament light chain with a TAG codon at the position K363 & an N-terminal FLAG tag (DYKDDDDK) in mammalian cells. Can be used for genetic code expansion & click labeling of NFL.DepositorInsertmouse neurofilament light chain with a K363TAG mutation (Nefl Mouse)
TagsFLAG tag (DYKDDDDK)ExpressionMammalianMutationK363TAGPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only
