We narrowed to 12,018 results for: cel.2;
-
Plasmid#32244DepositorUseLuciferaseTagsExpressionMammalianMutationPromoter region 5' UTRPromoter5' UTRAvailable sinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pYL214
Plasmid#171031PurposeCRISPR plasmids encodes Cas9 and a sgRNA targeting EZH2 exon 2 - intron 2 junction (sequence: GCAGACGAGCTGATGAAGTAA)DepositorInsertEZH2 (EZH2 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-1_VNp-FGF21
Plasmid#182407PurposeBacterial expression of Vesicle Nucleating peptide-fgf21 fusionDepositorInsertVNp-fgf21 (FGF21 Human)
UseTagsVesicle Nucleating peptide (VNp)ExpressionBacterialMutationPromoterT7Available sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(Luc)-GFP
Plasmid#197887PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre and the leakage expression is significantly reduced without CreDepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
HA-VHL C162F-pRc/CMV
Plasmid#22042DepositorInsertvon Hippel-Lindau tumor suppressor (VHL) (VHL Human)
UseTagsHA-tagExpressionMammalianMutationpoint mutant, converting aa 162 from Cysteine to …PromoterAvailable sinceSept. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-pDUXChd:hDUX4ctd-ca
Plasmid#198237PurposeLentivector with tet-inducible porcine DUXC/human DUX4 chimera (codon altered)DepositorInsertDUX4L pDUXChd:hDUX4ctd (codon altered) (DUX4 Human, S. scrofa (porcine))
UseLentiviralTagsExpressionMammalianMutationcodon alteredPromoterTREAvailable sinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
HA-VHL L158S-pRc/CMV
Plasmid#22041DepositorInsertvon Hippel-Lindau tumor suppressor (VHL) (VHL Human)
UseTagsHA-tagExpressionMammalianMutationpoint mutant converting aa 162 from Cysteine to P…PromoterAvailable sinceSept. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2VL-IRES-dOrai-IRES-mCherry
Plasmid#72898PurposeMammalian expression of dmBACCS2VL, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and mCherryDepositorInsertdmBACCS2VL-IRES-dOrai-IRES-mCherry
UseTagsIRES-mCherryExpressionMammalianMutationPromoterCMVAvailable sinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2NS-IRES-dOrai-IRES-mCherry
Plasmid#72896PurposeMammalian expression of dmBACCS2NS, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and mCherryDepositorInsertdmBACCS2NS-IRES-dOrai-IRES-mCherry
UseTagsIRES-mCherryExpressionMammalianMutationPromoterCMVAvailable sinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL-p21UTRm2
Plasmid#20879DepositorInsertp21 3'UTR site 2 mutation (Cdkn1a Mouse)
UseLuciferaseTagsExpressionMammalianMutationPredicted miRNA binding site 2 (Position ~1100) G…PromoterAvailable sinceMarch 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HRPT2 136X
Plasmid#11049DepositorInsertHRPT2 136X (CDC73 Human)
UseTagsflagExpressionMammalianMutationtruncation mutant with a stop codon introduced at…PromoterAvailable sinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2VL-IRES-dOrai-IRES-GFP
Plasmid#72897PurposeMammalian expression of dmBACCS2VL, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and GFPDepositorInsertdmBACCS2VL-IRES-dOrai-IRES-GFP
UseTagsIRES-GFPExpressionMammalianMutationPromoterCMVAvailable sinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HRPT2 227X
Plasmid#11050DepositorInsertHRPT2 227X (CDC73 Human)
UseTagsflagExpressionMammalianMutationtruncation mutant with a stop codon introduced at…PromoterAvailable sinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
CIP2Aprom27bp-pGL4.10Luc
Plasmid#60876PurposeLuc reporter driven by 27 bp of the CIP2A promoterDepositorInsert27 bp promoter fragment of Cancerous Inhibitor of PP2A (CIP2A Human)
UseLuciferase; PromoterlessTagsExpressionMutationPromoterAvailable sinceApril 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-miRFP703-eDHFR(69K6)-cRaf
Plasmid#184717PurposeiRafDepositorInsertmiRFP703-eDHFR(69K6)-cRaf (RAF1 Human, Synthetic)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(103)-GFP
Plasmid#197890PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(553)-GFP
Plasmid#197888PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(285)-GFP
Plasmid#197889PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
KTK_139
Plasmid#180565PurposeSpacer sequence in D1.1 format. Allows for Level 2 cloning with D1.2DepositorInsertSpacer sequence in D1.1 format. Allows for Level 2 cloning with D1.2
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EngPDm
Plasmid#64040PurposeMammalian expression of mutant paired domain of Pax8 fused to the N-terminal repressor domain of the drosophila engrailed protein (Eng)DepositorInsertPax8 paired domain (Pax8 Mouse)
UseTagsEng (N-terminal repressor domain of the drosophi…ExpressionMammalianMutationpaired domain, aa 1-147, with aa 30 to 32 changed…PromoterCMVAvailable sinceApril 23, 2015AvailabilityAcademic Institutions and Nonprofits only