We narrowed to 22,253 results for: his
-
Plasmid#63585PurposeA subunit of the Trithorax-related (Trr) methyltransferase complex.DepositorAvailable SinceNov. 3, 2015AvailabilityAcademic Institutions and Nonprofits only
-
-
pAct-GST-H3(K27Q)
Plasmid#182843Purposea K27Q point mutation (AAG/CAG) of Drosophila histone H3 was generated from pAct-GST-H3. Expression in S2 cells.DepositorInsertGST-histone H3 fusion
UseTagsGSTExpressionInsectMutationPromoterActin5CAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAct-GST-H3
Plasmid#182842PurposeA PCR product encoding GST-H3 (Drosophila histone H3) was was inserted into a modified pAct-5c vector by Sac I and Sal I sites. Expression in S2 cells.DepositorInsertGST-histone H3 fusion
UseTagsGSTExpressionInsectMutationPromoterActin5CAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pCS-H2B-mRFP1
Plasmid#53745PurposeContains a fusion of human histone H2B to monomeric red fluorescent protein 1 in the pCS2+ expression vectorDepositorInserthistone H2B (H2BC21 Human)
UseTagsmRFPExpressionMammalianMutationPromotersimian CMV IE94Available SinceJuly 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCS-H2B-cerulean
Plasmid#53748PurposeContains a fusion of human histone H2B to cerulean fluorescent protein in the pCS2+ vector.DepositorInserthistone H2B (H2BC21 Human)
UseTagsCeruleanExpressionMammalianMutationPromotersimian CMV IE94Available SinceJuly 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
human EB1 in PET28a for protein expression
Plasmid#39297DepositorAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAP007
Plasmid#206809PurposepET-6xHis-MBP-TEV-BabTIR-APAZ/BabAgo - Heterologous BabSPARTA expressionDepositorInsertBabSPARTA operon (6xHis-MBP-BabTIR-APAZ and BabAgo)
UseTags6xHis-MBPExpressionBacterialMutationPromoterT7Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.2-GS3
Plasmid#204755PurposeExpression of Cas9 and human H2A.2DepositorAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
HDAC6 Flag
Plasmid#13823PurposeMammalian expression of human histone deacetylase 6 with flag tagDepositorAvailable SinceFeb. 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
p300 KAT LIC 1M
Plasmid#233587PurposeBacterial expression of p300 KAT enzymeDepositorAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHLmMBP-3
Plasmid#72345PurposeMammalian expression of secreted N-terminally 8His-tagged mMBP-fused proteins with C-terminal 6His-tag/Strep-tag II/HA-tagDepositorTypeEmpty backboneUseTags6His-tag, 8His-tag, HA-tag, Strep-tag II, and mMB…ExpressionMammalianMutationPromoterCMV enhancer + chicken beta-actin promoterAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pH3R-mCherry-N1
Plasmid#84327PurposeHistamine-3 receptor tagged with mCherryDepositorAvailable SinceDec. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pH2R-mCherry-N1
Plasmid#84326PurposeHistamine-2 receptor tagged with mCherryDepositorAvailable SinceDec. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-DEST40-SIRT1
Plasmid#242124PurposeExpression in mammalian cellsDepositorAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST
Plasmid#174007PurposeCre dependent co-expression of jGCaMP8s and soma-targeted ChrimsonR under the control of an hSyn promoter. jGCaMP8s and ChrimsonR are separated by cleavable peptide sequence P2A.DepositorHas ServiceAAV9InsertjGCaMP8s-P2A-ChrimsonR-ST
UseAAVTags6xHis and soma targeting motifExpressionMutationPromoterhSynAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJL046
Plasmid#198807PurposeIn vivo neuronal inhibition through histamine-gated chloride channel. Neurons expressing HisCl1 transgene are inhibited after addition of histamine.DepositorInsert15xUAS::HisCl1-SL2-GFP::let-858 3'UTR
UseTagsExpressionWormMutationPromoterAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHLmMBP-10
Plasmid#72348PurposeMammalian expression of secreted N-terminally 8His-tagged mMBP TEV cleavage site-linked fusion proteins with C-terminal 6His-tag/Strep-tag II/HA-tagDepositorTypeEmpty backboneUseTags6His-tag, 8His-tag, HA-tag, Strep-tag II, and mMB…ExpressionMammalianMutationPromoterCMV enhancer + chicken beta-actin promoterAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
HDAC4 Flag
Plasmid#13821PurposeMammalian expression of human histone deacetylase 4 with flag tagDepositorAvailable SinceFeb. 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
p300dAIL KAT LIC 1M
Plasmid#233588PurposeBacterial expression of p300 KAT enzyme with truncated autoinhibitory loopDepositorInsertp300dAIL KAT (EP300 Human)
UseTags6xHis MBPExpressionBacterialMutationdeleted amino acids 1523-1554PromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pH4R-mCherry-N1
Plasmid#84328PurposeHistamine-4 receptor tagged with mCherryDepositorAvailable SinceDec. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pH2R-P2A-mCherry-N1
Plasmid#84331PurposeCo-expresses (untagged) Histamine-2 receptor and mCherryDepositorAvailable SinceDec. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pH4R-P2A-mCherry-N1
Plasmid#84333PurposeCo-expresses (untagged) Histamine-4 receptor and mCherryDepositorAvailable SinceDec. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pH3R-P2A-mCherry-N1
Plasmid#84332PurposeCo-expresses (untagged) Histamine-3 receptor and mCherryDepositorAvailable SinceDec. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDE714
Plasmid#103021Purposeexpression of a Cpf1 programming crRNA targetting HIS4 (crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGG198
Plasmid#165605PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with two hEGFP protospacers: PS1(upstream of promoter with 'CAGCG' PAM)-lac-PS2(downstream with 'CGGCG' PAM)-HIS3 and GFPDepositorInserthEGFP protospacer ('CGGCG' PAM) downstream of the HIS3/GFP promoter
UseSynthetic BiologyTagsExpressionBacterialMutationSecondary protospacer ('CGGCG' PAM) ins…PromoterlacAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHDT1:HDT1-GFP
Plasmid#108565PurposeArabidopsis transformation, expresses HDT1/GFP fusion with HDT1 promoter to study expression pattern in rootsDepositorAvailable SinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHDT1:GUS
Plasmid#108441PurposeArabidopsis transformation, expresses HDT1 promoter/GUS fusion to study expression pattern in rootsDepositorAvailable SinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
H3K9me3 biosensor
Plasmid#120802PurposeFRET biosensor. To monitor histone H3 lysine 9 tri-methylation in mammalian cells by FRETDepositorInsertTruncated YPet-HP1-EV linker-ECFP-mouse histone H3
UseTagsExpressionMammalianMutationPromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+) NRP1 b1b2 (273-586)
Plasmid#162733PurposeBacterial expression the b1b2 tandem domains from the rat Neuropilin 1 receptor (NRP1). With an N-terminal 6His tag and thrombin cleavage site.DepositorInsertHuman NRP1 b1b2 domains (residues 273-586)
UseTags6HisExpressionBacterialMutationCodon optimisedPromoterAvailable SinceMarch 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorUseCRISPRTagsExpressionYeastMutationPromoterSNR52Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX022
Plasmid#167148PurposeMoClo-compatible Level 0-CDS2 promoterless vector encoding C-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertC-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX021
Plasmid#167147PurposeMoClo-compatible Level 0-SP promoterless vector encoding N-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertN-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET24TEV-tSHIP1
Plasmid#183770PurposeExpresses C-terminal truncated SHIP1 (tSHIP1)with C-terminal TEV and 6HIS tags from pET24 backboneDepositorInsertSHIP1 (INPP5D Human)
UseTags6HIS and Tobacco Etch Virus (TEV) Cleavage siteExpressionBacterialMutationincludes aa1 to aa883 onlyPromoterT7 lacAvailable SinceJune 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
K9L mutant of H3K9me3 biosensor
Plasmid#120807PurposeFRET biosensor. Eliminating the H3 lysine 9 methylation site in H3K9me3 biosensor to abolish the detection capabilityDepositorInsertTruncated YPet-HP1-EV linker-ECFP-mouse histone H3(K9L mutation)
UseTagsExpressionMammalianMutationlysine 9 is mutated to leucine 9 on histone H3PromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPF101-pfQC-WT
Plasmid#184877Purposeexpresses soluble plasmodium falciparum QC protein with a histagDepositorInsertpfQC-wt
UseTagsHis tagExpressionBacterialMutationPromoterAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only