We narrowed to 11,980 results for: SOM
-
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyso-ExRai-CKAR2
Plasmid#236100PurposeEnhanced excitation-ratiometric biosensor for monitoring Protein Kinase C activity in living cells, targeted to lysosome surface.DepositorInsertLAMP1-ExRai-CKAR2 (LAMP1 Human, Synthetic)
TagsFull-length LAMP1ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA355_sgCiCh2-2
Plasmid#229021PurposeExpression of a CRISPRi doxycycline inducible control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertsgChr2-2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pINQ-ON10
Plasmid#198689PurposePeriplasmic expression of anti-SARS-Cov-2 Nucleocapsid nanobody ON10 (HA-tagged) in BL21(DE3)DepositorInsertanti-SARS-CoV-2 Nucleocapsid nanobody ON10
Tags6xHis tag, HA tag, OmpA signal peptide, and Ribos…ExpressionBacterialPromoterT7 promoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINQ-NbH4
Plasmid#198690PurposePeriplasmic expression of anti-SARS-Cov-2 Nucleocapsid nanobody H4 (AviTag) in BL21(DE3)DepositorInsertanti-SARS-CoV-2 Nucleocapsid nanobody H4
Tags6xHis tag, Avitag, OmpA signal peptide, and Ribos…ExpressionBacterialPromoterT7 promoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PMP34-mApple-NFAST(low)
Plasmid#214418PurposePeroxisome localization of low-affinity NFAST fused to PMP34-AppleDepositorAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFSynW SYT9 D197, 199, 330, 332N IRES GFP
Plasmid#195703PurposeLentiviral plasmid encoding SYT9 with D197, 199, 330, 332N mutations followed by an internal ribosomal entry site followed by EGFP under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZ157
Plasmid#163639Purposepcn-1>PCN-1::GFP expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWZ186
Plasmid#163641Purposerps-27>DHB::2xmKate2 expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB:2xmKate2::3xHA
UseCRISPRTags2xmKate2ExpressionWormPromoterrps-27Available SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR2
Plasmid#176245PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR2
Plasmid#176248PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR1
Plasmid#176247PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR3
Plasmid#176246PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 3DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-FRT-TO-KIF1A(1-365)-VVDfast-mVenus-SSPB(micro)_P2A_iLID-mCherry-RAB11
Plasmid#174646PurposeOptogenetic coupling of RAB11 to opto-kinesin to induce anterograde transport of recycling endosomes. Compatible with Flp-in TREX system.DepositorInsertKIF1A(1-365)-VVDfast-mVenus-SSPB(micro)-P2A-iLID-mCherry-RAB11
ExpressionMammalianMutationmmKIF1A(aa1-365): Pro202Ala; mVenus: Met1Del, Thr…PromoterCMV (with TetOn)Available SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR3
Plasmid#176249PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 3DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD440
Plasmid#168466PurposeFor the insertion pf NLS-mCherry-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mCherry-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD441
Plasmid#168467PurposeFor the insertion pf NLS-mEGFP-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mEGFP-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD442
Plasmid#168468PurposeFor the insertion of NLS-eYFP-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-eYFP-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD443
Plasmid#168469PurposeFor the insertion pf NLS-mScarlet-I-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mScarlet-I-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD444
Plasmid#168470PurposeFor the insertion of NLS-mNeonGreen-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mNeonGreen-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD437
Plasmid#168463PurposeFor the insertion pf NLS-mEos3.2-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mEos3.2-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
pJET1.2_Bod1l_Sense
Plasmid#124443PurposePlasmid for sense in situ probe in vitro transcriptionDepositorInsertBiorientation of chromosomes in cell division 1-like (Bod1l Mouse)
UseIn situ probePromoterT7Available SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCE-mp53DD
Plasmid#41856PurposeNon-integrating (episomal) expression of mouse p53DD - p53 carboxy-terminal dominant-negative fragmentDepositorAvailable SinceJuly 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PalmGRET
Plasmid#158221PurposeBRET-based reporter to enable pan-extracellular particle labelling ranging from exomeres (< 50 nm) to small (< 200 nm; e.g. exosomes) and medium and large (> 200 nm; e.g. microvesicles) EVs.DepositorInsertPalmGFP-Nluc
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCE-hUL
Plasmid#41855PurposeNon-integrating (episomal) expression of human L-MYC and LIN28DepositorAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-mp53DD
Plasmid#41859PurposeNon-integrating (episomal) expression of mouse p53DD - p53 carboxy-terminal dominant-negative fragmentDepositorAvailable SinceJuly 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B WT
Plasmid#123230PurposeExpresses mCherry-EGFP-LC3B wild-type in mammalian cells. Fluorescent tandem reporter for autophagosomes. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-SOD2-2A-Catalase-WPRE
Plasmid#67635PurposeAAV vector expressing both SOD2 and mitochondrial targeted CatalaseDepositorUseAAVMutationDeleted the Peroxisome Targeting Signal from Cata…PromoterCMVAvailable SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ASAP4e-Kv-WPRE
Plasmid#201031PurposeExpresses somatically enriched ASAP4e in neurons, can be used to package AAVDepositorInsertASAP4e-Kv
UseAAVAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV mClover3-Galectin-3
Plasmid#215376PurposeExpression of the endolysosomal damage marker Galectin-3 with an N-terminal mClover3 tag.DepositorInsertLGALS3 (LGALS3 Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only