We narrowed to 1,482 results for: ARAB-1
-
Plasmid#37312DepositorInsertGAI (GAI Mustard Weed)
TagsCFP and LynExpressionMammalianMutationcontains aa 1-151PromoterCMVAvailable SinceJune 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
Cry2 mCherry PGK-1 in pcDNA3.1
Plasmid#64214PurposemCherry fused between Cry2 and PGK-1 to study cell migrationDepositorTagsmcherryExpressionMammalianPromoterCMVAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDV21 [pSNG-1::SNG-1::CRY2(D387A)olig(535)::SL2::mCherry]
Plasmid#197599PurposePan-neuronal expression of SNG-1::CRY2(D387A)olig(535) in neurons of C. elegans. CRY2(D387A) is photoinactiveDepositorExpressionWormMutationD387A, E490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPHR-mCherry-PGL-1-mHP1alpha
Plasmid#181894PurposeSoluble light-dependent effector protein (HP1alpha fused to PGL-1) for optodroplet formation or recruitment to CIBN localizersDepositorInsertPHR-mCherry-PGL-1-mHP1alpha (Cbx5 Mouse, Mustard Weed)
TagsPHR-mCherryExpressionMammalianPromoterCMVAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-CERK1 D441V-YFPc-1
Plasmid#102403Purposesplit YFP. Plant expression of CERK1 D441V-YFPc-1DepositorAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSumo-His6-SUMO-AtTPR1(1-209)
Plasmid#177858PurposeBacterial Expression of TPR1DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSumo-His6-SUMO-AtTPR2(1-209)
Plasmid#177860PurposeBacterial Expression of TPR2DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSumo-His6- Sumo-AtTPL(1-209)
Plasmid#177856PurposeBacterial Expression of TPLDepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-attB2-SA(1)-CRY2-mCherry
Plasmid#160440PurposeTo create Cry2-mCherry lines from MiMIC lines with inserts into coding introns in Phase 1.DepositorAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-His(6)-TEV-AtPCO4-1(wt)
Plasmid#191801PurposeFull length wt AtPCO4 with Nt-His tagDepositorInsertAtPCO4-1
Tags6xHis, TEV cleavage siteExpressionBacterialAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cry2 mCherry RGS4(del 1-33) in pcDNA3.1
Plasmid#64207PurposemCherry fused between Cry2 and RGS4(del 1-33) to study cell migrationDepositorTagsmcherryExpressionMammalianPromoterCMVAvailable SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1-AtRBX1-T7-HsSKP1-T7-AtCUL1-S
Plasmid#228944PurposeExpression AtRBX1-T7, HsSKP1-T7 and AtCUL1-S in in bacterial cellsDepositorTagsS-Tag and T7ExpressionBacterialAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pENTR/D-Topo genomic A. thaliana IMPORTIN ALPHA 1
Plasmid#175814PurposepENTR plasmid with genomic sequence of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 1 (AT3G06720) without stop codon for C-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 1 (IMPA-1 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnonePromoternoneAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDV18 [punc-47::SNG-1::CRY2olig(535)]
Plasmid#197598PurposeExpression of SNG-1::CRY2olig(535) in GABAergic motor neurons of C. elegansDepositorExpressionWormMutationE490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-22b(+)_PelB-BN0035-1-FLAG-His
Plasmid#218030PurposeRESOLUTE SLC binder expression plasmidDepositorInsertBN0035-1
Tags1xFLAG 10xHis and PelBExpressionBacterialAvailable SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-22b(+)_PelB-BN00MN-1-FLAG-His
Plasmid#218041PurposeRESOLUTE SLC binder expression plasmidDepositorInsertBN00MN-1
Tags1xFLAG 10xHis and PelBExpressionBacterialAvailable SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-22b(+)_PelB-BN009T-1-FLAG-His
Plasmid#218068PurposeRESOLUTE SLC binder expression plasmidDepositorInsertBN009T-1
Tags1xFLAG-10xHis and PelBExpressionBacterialAvailable SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV06 [punc-17::SNG-1::CRY2(535)]
Plasmid#197597PurposeExpression of SNG-1::CRY2olig(535) in cholinergic motor neurons of C. elegansDepositorExpressionWormMutationE490GAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLIII CKBs CRISPR with guides at 1-2 and 2-3
Plasmid#238525PurposePlant expression of Cas9 and gRNAs against A. thaliana CK2alpha3DepositorAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLTS
Plasmid#59386PurposeExpresses the lambda Red recombinase under control of the arabinose-inducible P(araB) promoter and I-SceI under control of the anhydrotetracycline-inducible P(tetA) promoter.DepositorTypeEmpty backboneUseGenome engineeringExpressionBacterialAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
MBP-CRY1-PHR
Plasmid#26035DepositorAvailable SinceDec. 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
pENTR4 CDS A. thaliana PARP1
Plasmid#175818PurposepENTR4 plasmid with CDS of Arabidopsis thaliana POLY(ADP-RIBOSE) POLYMERASE 1 (PARP1, AT2G31320.1) without stop codon for C-terminal epitope tagsDepositorInsertPARP1 (PARP1 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnoneMutationone silent mutation, annotated in GenBank filePromoternoneAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDDGFP2_leu2d_NRT1.1
Plasmid#58332PurposeExpresses Arabidopsis thaliana NRT1.1 in Saccharomyces cells as a C-terminal GFP his tagged proteinDepositorAvailable SinceAug. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 CDS A. thaliana PHOT1
Plasmid#209187PurposepENTR4 plasmid with CDS of Arabidopsis thaliana PHOTOTROPIN 1 (PHOT1, AT3G45780.1) without stop codon for C-terminal epitope tagsDepositorAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pICSL11015
Plasmid#117499PurposeFAST-Red selectable marker Golden Gate Level 1 Position 1DepositorInsertBpiI:TGCC:pOLE1:OLE1-RFP:OLE1t:GCAA:BpiI
TagsRFPExpressionPlantPromoterAtOLE1Available SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pETDuet-AtRBX1-T7-AtSKP1-T7-AtCUL1-S
Plasmid#238003PurposeExpression AtRBX1-T7, AtSKP1-T7 and AtCUL1-S in in bacterial cellsDepositorTagsS and T7ExpressionBacterialAvailable SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only