We narrowed to 115 results for: hpgk promoter
-
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS613_pTetR-P2A-BFPnls/sgTelo
Plasmid#108649PurposeTelomere-targeting Spy sgRNA under U6 promoterDepositorInsertsTelomere-targeting sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS614_pTetR-P2A-BFPnls/sgNS
Plasmid#108650PurposeNon-specific Spy sgRNA under U6 promoterDepositorInsertsNon-specific sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS887_pTetR-P2A-BFPnls/sgAlpha
Plasmid#108651PurposeAlpha satellite repeats targeting Spy sgRNA under U6 promoterDepositorInsertsAlpha satellite repeats targeting sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-shRNA
Plasmid#82697PurposeFor targeting shRNA construct into human AAVS1 locus, using genome editing. Expresses shRNA of interest (cloning: EcoRI and AgeI) under U6 promoter, flanked by AAVS1 homology arms.DepositorTypeEmpty backboneUseRNAiPromoterhPGK, U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pL40C_PGKintron_Cas9_Green
Plasmid#134966PurposeLentiviral vector coding Cas9 and mNeonGreenDepositorInsertCas9-P2A-mNeonGreen
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterhPGK promoter with beta-globin intronAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
DR.GFP
Plasmid#17617DepositorAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
pSc1-puro
Plasmid#80438PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cell, and also confers resistance to puromycinDepositorInsertssp Cas9 gRNA
eGFP
Puromycin resistance
UseCRISPRExpressionMammalianPromoterCMV, U6, and hPGKAvailable SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
EF.GFP
Plasmid#17616DepositorAvailable SinceApril 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLEX_305-N-dTAG-FRA1
Plasmid#188742Purposeexpresses murine Fosl1 (Fra1) with N-terminal tag FKBP F36V (dTAG) for the dTAG systemDepositorInsertFosl1 (Fosl1 Mouse)
UseLentiviralTagsFKBP F36V tag (dTAG)ExpressionMammalianPromoterhPGK promoterAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only