We narrowed to 9,360 results for: CAG
-
-
pLentiCRISPRv1-sgPHGDH-G5
Plasmid#83913Purposestable knockoutDepositorInsertPhosphoglycerate dehydrogenase (PHGDH Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceOct. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC763 - pX458 with rat Rosa26 gRNA A
Plasmid#113161PurposeA plasmid that expresses a guide RNA targeting rat Rosa26 as well as FLAG-tagged SpCas9 and GFPDepositorInsertgRNA for rat Rosa26
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgTP53(R273)
Plasmid#85561PurposeExpresses sgRNA targeting human TP53 around codon R273DepositorInserttumor protein p53 (TP53 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458-sgEIF4EBP1
Plasmid#128097PurposeCRISPR gRNA against human EIF4EBP1 (4EBP1) with Cas9 from S. pyogenes and 2A-EGFPDepositorInsertCRISPR sgRNA against human 4EBP1 (EIF4EBP1 Human)
UseCRISPRExpressionMammalianPromoterhU6Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-46: MYL7-mEGFP
Plasmid#114413PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL7, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL7 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL7 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA4(43))-PGKpuro2ABFP-W
Plasmid#200464PurposeLentiviral vector expressing gRNA targeting human SMARCA4DepositorInsertSMARCA4(43) (SMARCA4 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-2
Plasmid#118020PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
ATM gRNA (BRDN0001146099)
Plasmid#77530Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK1 gRNA (BRDN0001149093)
Plasmid#77788Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK1 gRNA (BRDN0001147355)
Plasmid#77787Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-CACNA1E KI
Plasmid#131481PurposeEndogenous tagging of CaV2.3, R: N-terminal (amino acid position: G5)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-sgAAVS1
Plasmid#83906Purposestable knockoutDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-1
Plasmid#223223Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-puro-shWRN1
Plasmid#125783PurposeDOX-inducible expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
AKT3 gRNA (BRDN0001146868)
Plasmid#76217Purpose3rd generation lentiviral gRNA plasmid targeting human AKT3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-puro-shWRN2
Plasmid#125785PurposeDOX-inducible expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN2 (WRN Human)
UseRNAiAvailable SinceAug. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
shERK2b-mlpx-puro
Plasmid#65230Purposeencodes a shRNA against ERK2DepositorAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-puro-shWRN1-C911
Plasmid#125784Purposea seed-matched control for pRSITEP-puro-shWRN1DepositorInsertshWRN1-C911 (WRN Human)
UseRNAiAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-LRRK2-G2019S-3a
Plasmid#180432PurposeTransiently expressing a pegRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianMutationLRRK2-G2019SPromoterU6Available SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
PRKDC gRNA (BRDN0001145772)
Plasmid#77862Purpose3rd generation lentiviral gRNA plasmid targeting human PRKDCDepositorAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM30-ARC105
Plasmid#133426PurposeHuman ARC105 coding sequence in vector for in vitro transcription and protein expression, with T7 promoter.DepositorInsertPCQAP (MED15 Human)
ExpressionBacterialMutationContains amino acids 5-78 fused to C-terminal of …Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-5
Plasmid#118023PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-puro-shWRN2-C911
Plasmid#125786Purposea seed-matched control for pRSITEP-puro-shWRN2DepositorInsertshWRN2 (WRN Human)
UseRNAiAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
CHUK gRNA (BRDN0001149372)
Plasmid#77033Purpose3rd generation lentiviral gRNA plasmid targeting human CHUKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shWRN1
Plasmid#125781Purposeconstitutive expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-4)-PGKpuroBFP-W
Plasmid#211986PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
B52 + CHEK2 sgSTOP
Plasmid#100712PurposeB52 plasmid expressing CHEK2 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting CHEK2 (cloned using BbsI) (CHEK2 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only
