We narrowed to 7,665 results for: RAP
-
Plasmid#123206PurposeGateway entry clone encoding human MAP1LC3B G120A lacking stop codon, suitable for C-terminal taggingDepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
UseGateway entry vector / entry cloneMutationGlycine 120 to Alanine, stop codon removedAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTYB-pLAC-L108S/L109S/F112S
Plasmid#48730PurposeBacterial expression of Lacritin Protein with Mutation at proteins 108 and 109 Leucine to Serine and 112 from phenylalanine to serineDepositorInsertLacritin (LACRT Human)
TagsInteinExpressionBacterialMutationLeucine 108 and 109 to Serine; phenylalanine 112 …PromoterT7Available SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
PL-5LTR-RGR(DMD#1)-AmCyan-A
Plasmid#138482PurposeExpresses sgRNA targeting human DMD (Dystrophin) for packaging into NanoMEDIC particle.DepositorInsertRibozyme-flanked gRNA and AmCyan
UseCRISPRExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pW17
Plasmid#158207Purpose2lox landing pad plasmid with mariner transposon and transposase used for CRAGEDepositorInsertloxP/Cre/KmR/Lox5171/Mariner IR oriT/transposase
Available SinceDec. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B WT
Plasmid#123230PurposeExpresses mCherry-EGFP-LC3B wild-type in mammalian cells. Fluorescent tandem reporter for autophagosomes. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetO-hNGN2-Puro
Plasmid#79049PurposeExpresses human NEUROGENIN2 (hNGN2) and puromycin resistance gene under control of TetON promoter. This lentiviral vector is used to generate NGN2-iNs (induced neurons) from hiPSCs and hiPSC-NPCs.DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMVP-SEC24C
Plasmid#231559PurposepMVP expression vector for human SEC24C (wild type, closed, resistant to sgSEC24C #1 and #2) (Blasticidin selection marker)DepositorInsertSEC24C (SEC24C Human)
UseLentiviralTagsV5ExpressionMammalianMutationsilent PAM mutations (G67 (GGG>GGA) and A115 (…PromoterCMVAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a-gp32-H6
Plasmid#163912PurposeExpresses T4 gp32 for bacterial expression and affinity purificationDepositorInsertgp32
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBAD-WzxE-TEV-His10
Plasmid#226781PurposeExpression of C-terminally TEV cleavable His10-tagged WzxE from E. coli in E. coliDepositorInsertwzxE
TagsTEV cleavable 10xHistidine tagExpressionBacterialMutationvaline insertion in position 2 due to the cloning…PromoteraraBADAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-N1-YAPS127A
Plasmid#166458PurposeExpresses fusion of mEGFP and YAPS127ADepositorInsertmEGFP, YAPS127A (YAP1 Human)
ExpressionMammalianAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIG-747_CD19-28z_CAR_TFAP4
Plasmid#207489PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertTFAP4, CD19-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXD023 - pLKO-EF1a-Puro-P2A-FLuc-WPRE
Plasmid#192203PurposeLenti-PL(Puro-Luciferase)DepositorInsertLenti-PL(Puro-Luciferase)
UseLentiviral; Mammalian expressionMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 1 tet pLKO puro
Plasmid#162985PurposeTet-inducible shRNA targeting human METTL3 #1DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinFL
Plasmid#187271PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin full lengthDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
OPEN Beta2-microglobulin
Plasmid#215657PurposeE. coli expression of human beta-2-microglobulin containing a cysteine mutation for disulfide linkage to mutant HLA.DepositorInsertOPEN Beta2-microglobulin (B2M Human)
ExpressionBacterialMutationHistidine 31 to CysteinePromoterT7Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXD024 - pLKO-EF1a-GFP-P2A-FLuc-WPRE
Plasmid#192204PurposeLenti-GL(GFP-Luciferase)DepositorInsertLenti-GL(GFP-Luciferase)
UseLentiviral; Mammalian expressionMutationNAAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY093-EFS-BCMA-Blast-WPRE
Plasmid#192194PurposeLenti-BCMA-OE-BlastDepositorAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_BFP_2A-mIL10
Plasmid#247507PurposeExpresses mouse IL-10 and BFPDepositorInsertmouse IL-10 and BFP constitutive (Il10 Mouse, Synthetic)
UseLentiviralTagsbfpExpressionMammalianAvailable SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-p21
Plasmid#171122PurposeDoxycycline inducible expression of p21DepositorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only