We narrowed to 26,611 results for: RON
-
Plasmid#137156PurposeIntersectional viral expression of ic++-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-iC++-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR4_miniFXN_8
Plasmid#234361PurposeMini FXN plasmid with a partial deletion of the 5' UTR and a large deletion of intron 1 in FXN. Does not contain GAA repeats.DepositorInsertFXN (FXN Human)
UseCloningTagsFlag TagMutationThere is a partial deletion in the 5'UTR of …Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E3-E4-En-1 (GB2244)
Plasmid#160566PurposeGBoligomers for the position [3_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (E3-E4-En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAcGP67A-TfR
Plasmid#12130DepositorInserttransferrin receptor (TFRC Human)
Tags6X-His tag, Factor Xa cleavage site, and leader p…ExpressionInsectMutationThe portion of the human TfR gene encoding residu…Available SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRepair-SGFP2-CTNNB1
Plasmid#153430PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with SGFP2DepositorInsertCTNNB1 homology arms and mTurquoise2 coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsSGFP2Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-ATG
Plasmid#153429PurposeExpresses a gRNA that overlaps the startcodon of human CTNNB1DepositorAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
hSyn-GtACR2-ChRmine-tandem-eYFP
Plasmid#192580PurposeAAV-vector for bidirectional optogenetic manipulation of neuronsDepositorInsertsomBiPOLES
UseAAVTagsEYFP- soma-targeting motif from Kv2.1 channelExpressionMammalianPromoterhuman synapsinAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 sequence: GTCGCTACCTACAGCCAGGA, Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i1-ipUSEPR-TR657
Plasmid#228953PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i1 (Cdkn1a Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i2-ipUSEPR-TR657
Plasmid#228954PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i2 (Cdkn1a Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIRESh-GFPII-SM-Dlk1
Plasmid#108932PurposeGFP-tagged vector expressing full length isoform of Dlk1DepositorAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
AcGFP-PMS2
Plasmid#215124PurposeExpresses AcGFP-PMS2 in mammalian cells from a retroviral vector.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV pTRE-FLEX-EGFP-WPRE-bGHpA
Plasmid#65449PurposeCan be used to generate AAV virus that will express EGFP from the tetO promoter in a Cre-dependent mannerDepositorInsertEGFP
UseAAVPromotertetOAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon-iC++-EYFP
Plasmid#137155PurposeIntersectional viral expression of iC++-EYFP in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-iC++-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon/Von eYFP
Plasmid#137164PurposeIntersectional viral expression of EYFP in cells expressing Cre AND Flp AND VcreDepositorHas ServiceAAV Retrograde and AAV8Insert3x-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PGK-HA-PGRN-LAMP1TM
Plasmid#234873PurposeLentiviral plasmid expressing HA-tagged human progranulin that is fused to the transmembrane domain and cytosolic tail of LAMP-1. Enables lysosomal delivery of progranulin without secretion.DepositorInsertProgranulin (GRN Human)
UseLentiviralTagsHA tag and LAMP-1 transmembrane domain and cytoso…ExpressionMammalianPromoterPGKAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-sRGECO
Plasmid#137126PurposeIntersectional viral expression of sRGECO in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-sRGECO
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE217DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1586
Plasmid#121057PurposemKate2^SEC^AID*::3xFLAG vector with ccdB sites for cloning homology arms.DepositorInsertmKate2-T^SEC^AID*::3xFlag
UseCRISPR and Cre/LoxTags3xFLAG, C. elegans codon optimized mKate2, and au…ExpressionWormAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-oScarlet
Plasmid#137137PurposeIntersectional viral expression of oScarlet in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE95DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CDK5RAP2-SVA-BFP
Plasmid#202824PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CDK5RAP2 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within CDK5RAP2 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only