We narrowed to 83,701 results for: TRI
-
Plasmid#219749PurposeDVK_AF CIDAR vector encoding hispidin-synthase from Mycena citricolor under control of CMV promoter, for mammalian expressionDepositorInsertpCMV - mcitHispS - tSV40
ExpressionMammalianAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWPT-/mEGFP-1T-IRES-mCherry
Plasmid#190190PurposeLentiviral expression vector with altered Kozak sequence to direct EGFP expression. mCherry expression is regulated by an IRES.DepositorInsertsmEGFP
mCherry
UseLentiviralMutationchanged EGFP Kozak sequence inserting a C>T mo…PromoterEIF1-shortAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CMV-Grid2(I677C)
Plasmid#164782Purposecysteine mutated glutamate delta2 receptor (I677C) for the attachment of a photoswitchable tethered ligandDepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-PLK4-K41M-S285A-T289A-3xFLAG
Plasmid#69842PurposeThis plasmid encodes kinase dead PLK4 isoform 1 carrying K41M and S285A/T289A mutations with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorInsertPLK4 (PLK4 Human)
Tags3xFLAG tag and EGFPExpressionMammalianMutationK41M-S285A-T289APromoterCMVAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-cytoBirA-2A-mCherry_Ras
Plasmid#80066PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SEMPER_ACC-msfBFP[r5M]_ACC-msfGFP[r5M]_ACC-emiRFP670_IRES-mCherry
Plasmid#221081PurposeSEMPER plasmid for expression of msfGFP[r5M] and msfBFO[r5M] and emiRFP670 in ratios dictated by the trinucleotide TIS. Relative ORF expression is characterized in publicationDepositorInsertACC-msfBFP[r5M]_ACC-msfGFP[r5M]_ACC-emiRFP670_IRES-mCherry
ExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_mGFP-FGFR3-K650E
Plasmid#191757PurposeExpression of N-terminally mGFP labelled mutated FGFR3 (isoform IIIc)-K650E mutation (associated with TD2; target mutation: c.1948A>G; silent mutation added on purpose: c.1938C>T)DepositorInsertmGFP-FGFR3IIIc
TagsmGFPExpressionMammalianMutationc.1948A>G (p.K650E) + silent mutation c.1938C&…Available SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pMTB2-NLS-BirA-2A-mCherry_Ras
Plasmid#80067PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNUT N6His K206E/K534A hTFNG
Plasmid#70133PurposeExpresses N-His tagged nonglycosylated human serum transferrin unable to release iron from the N-lobe or the C-lobeDepositorInsertN6His K206e/K534A hTFNG (TF Human)
TagsN-terminal signal peptide, 4 aa link, 6 His, Fact…ExpressionMammalianMutationchanged Lys206 to a glutamic acid and Lys534 to a…PromoterSV40Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-miR-124-sponge_rev(neg. CTRL)
Plasmid#117326PurposeDual luciferase assay negative control for miR-124 bindingDepositorInsertreverse miR-124 sponge
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-miR-124-sponge (pos. CTRL)
Plasmid#117327PurposeDual luciferase assay positive control for miR-124 bindingDepositorInsertmiR-124 sponge
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Dakap-Venus-cpVenus-FLARE-AKAR
Plasmid#123338PurposeMitochondria-targeted yellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertDAKAP-Venus-cpVenus-FLARE-AKAR
TagsN-terminal 30 amino acids from DAKAP1, Venus, and…ExpressionMammalianPromoterCMVAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CreLite
Plasmid#131785PurposeAAV donor/transfer vector expressing CreLite system components, PhyBΔCreC and PIF6CreN, driven by CBh promoterDepositorInsertPhyBCreC-P2A-PIF6CreN
UseAAV, Cre/Lox, and Synthetic BiologyExpressionMammalianPromoterCBhAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Ma-sfGFP WT
Plasmid#197567PurposeExpression of sfGFP WT with Methanomethylophilus alvus (Ma) Pyl-tRNA for the encoding of non-canonical amino acids at TAG codons in HEK293 cellsDepositorInsertssfGFP WT
M. alvus Pyl-tRNA (6) (4x copies)
TagsV5-His6ExpressionMammalianPromoterCMV and U6/H1Available SinceApril 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT-myl7-cytoBirA-2A-mCherry_Ras
Plasmid#80060PurposeMyl7 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterMyl7 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLJM1 Flag GFP 4E-BP1 Rheb15
Plasmid#112761Purposeexpress GFP-4EBP1-Rheb15DepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIRESpuro-Flag-Pol b(K72A)
Plasmid#23258DepositorAvailable SinceMarch 31, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_mGFP-FGFR3-G380R
Plasmid#191755PurposeExpression of N-terminally mGFP labelled mutated FGFR3 (isoform IIIc)-G380R mutation (associated with ACH; target mutation: c.1138G>A; silent mutation added on purpose: c.1131C>T)DepositorInsertmGFP-FGFR3IIIc
TagsmGFPExpressionMammalianMutationc.1138G>A (G380R) + c.1131C>T (silent mutat…Available SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only