We narrowed to 2,594 results for: pCas
-
Plasmid#167296PurposePlasmid encoding for 2 gRNAs targeting the human BAX gene and a CMV driven nuclease Cas9 followed by self-cleaving EGFPDepositorInsertBAX (BAX Human)
ExpressionMammalianAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-NRRH-P2A-EGFP (RMD51)
Plasmid#197502PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-NRRH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-NRRH-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-NRRH(D10A/I32…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCBh-ABE8e-nSpCas9(D10A)[N-term] (HES1468)
Plasmid#197509PurposeCbh promoter expression plasmid for N-terminal intein-split AAV construct with N-term of ABE8e-nSpCas9(D10A)DepositorInsertAAV-[ITR]-pCBh-BPNLS-TadA8e-nSpCas9(D10A)[N-term]-NpuN-BPNLS-[ITR]
UseAAV and CRISPRTagsBPNLS and NpuN(intein)-BPNLSMutationABE8e mutations in TadA and nSpCas9(D10A)PromoterCbhAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-NRCH-SsAPOBEC3B
Plasmid#198550PurposeExpresses human codon-optimized SpCas9-NRCH-SsAPOBEC3B and blasticidin resistance: EFS promoter-SpCas9-NRCH-SsAPOBEC3B-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRCH-SsAPOBEC3B
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-nSpCas9-APOBEC1
Plasmid#209039PurposeLentiviral vector expressing doxycycline-inducible human codon-optimized cytosine base editor where APOBEC1 is fused to the N-terminus of SpCas9(D10A)-sDNA Rad51-2xUGI-6xNLSDepositorInsertAPOBEC1-nSpCas9
UseCRISPR and LentiviralTagsFLAG-HAExpressionMammalianMutationD10APromoterTight TRE promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-spCas9-pNeo
Plasmid#214120PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInsertspCas9
UseCRISPRExpressionMammalianMutationCodon-optimized for mammalian cellsAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_CALR sgRNA / hSpCas9
Plasmid#172838PurposeMammalian expression of a sgRNA targeting the intron 1 of CALR (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of CALR under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCASP-SptP120-TD-HilA
Plasmid#153330PurposeTriggers secretion of SptP120 fused to the HA4-7c12 Tandem Monobody from Salmonella upon induction with arabinoseDepositorInsertSptP120-HA4-7c12 Tandem Monobody
UseSalmonella expressionAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACYC-OspCas12c-noncoding
Plasmid#120878PurposeExpresses concatenated noncoding sequences surrounding the CRISPR-OspCas12c system in the native genomic loci; expresses the tracrRNA required for activity.DepositorInsertNoncoding sequences for CRISPR-OspCas12
UseCRISPRExpressionBacterialPromoterlacAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#3
Plasmid#107731PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#3
Plasmid#107728PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dHeFSpCas9
Plasmid#92116PurposeExpression plasmid for human codon-optimized dead/inactive increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive HeFSpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, N497A, R661A, Q695A, H840A, K848A, Q926A, K…PromoterCbhAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCaSpeR3/ncd-gfp #10
Plasmid#66082Purposestable germline transformation of Drosophila to produce Ncd-GFP expressionDepositorInsertNcd kinesin-14 motor protein (ncd Fly)
TagsGFPExpressionInsectMutationD699LPromoterncd promoter (3.1kb upstream region of ncd start …Available SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCaSpeR-act5cB-LexAQFw
Plasmid#61311PurposeExpresses chimeric transactivator LexA_DBD:QF2w_AD in DrosophilaDepositorInsertLexA_DBD::QF2w_AD
ExpressionInsectMutationChanged EK on C-terminus of QF2 to KKKKAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ef1a-pspCas13b-NES-3xFLAG-T2A-BFP
Plasmid#173029PurposeFor expression of cytoplasmic pspCas13b protein tagged with 3xHA-T2A-BFP for gene silencing in mamallian cells.DepositorInsertpspCas13b
UseCRISPR and LentiviralTags3xFLAG, BFP, HIV NES, and T2AExpressionMammalianPromoterEf1aAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-VQR-P2A-EGFP (RTW3520)
Plasmid#139990PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-VQR(D1135V/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-VQR with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationVQR=D1135V/R1335Q/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75240PurposeCRISPR/Cas9 plasmid against human IkarosDepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only