We narrowed to 2,598 results for: pCas
-
Plasmid#221550PurposeExpresses Cas9 and gRNA for disruption of TBK1 gene in human cellsDepositorAvailable sinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pattB-LSL-AAVR-F2A-spCas9
Plasmid#202459PurposeThe plasmid backbone used to generate the recombination template to generate the SELECTIV mice through Integrase Mediated Transgenesis. Allows for Cre-dependent expression of AAVR and Cas9.DepositorInsertAAVR (AU040320 Mouse)
UseCRISPR, Cre/Lox, and Mouse TargetingTagsmCherry fusionExpressionMammalianPromoterCAGAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Klenow-ST2-com-vector
Plasmid#176235PurposeVector plasmid for expressing spCas9-Klenow fusion protein and sgRNA. There are two copies of HBB 3’ UTR in the 3’UTR of spCas9-Klenow to enhance expression.DepositorTypeEmpty backboneExpressionBacterialAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9nucl-T2A-EGFP - BAXgRNA1- BAXgRNA2
Plasmid#167296PurposePlasmid encoding for 2 gRNAs targeting the human BAX gene and a CMV driven nuclease Cas9 followed by self-cleaving EGFPDepositorInsertBAX (BAX Human)
ExpressionMammalianAvailable sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pspCas9-3'UTR-Tetra-com-vector
Plasmid#132553PurposeExpresses spCas9 and sgRNA scaffold with com aptamer replacing the TetraloopDepositorInsertsCas9
sgRNA scaffold with com replacing the Tetraloop
ExpressionMammalianAvailable sinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCBh-ABE8e-nSpCas9(D10A)[N-term] (HES1468)
Plasmid#197509PurposeCbh promoter expression plasmid for N-terminal intein-split AAV construct with N-term of ABE8e-nSpCas9(D10A)DepositorInsertAAV-[ITR]-pCBh-BPNLS-TadA8e-nSpCas9(D10A)[N-term]-NpuN-BPNLS-[ITR]
UseAAV and CRISPRTagsBPNLS and NpuN(intein)-BPNLSMutationABE8e mutations in TadA and nSpCas9(D10A)PromoterCbhAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-NRRH-P2A-EGFP (RMD51)
Plasmid#197502PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-NRRH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-NRRH-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-NRRH(D10A/I32…PromoterCMV and T7Available sinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
BPK3274 - human expression plasmid for eSpCas9(1.1)-HF1
Plasmid#101177PurposeHuman expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant: CMV-T7-hSpCas9-eSpCas9(1.1)-HF1(N497A, R661A, Q695A, K848A, Q926A, K1003A, R1060A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-eSpCas9(1.1)-HF1(N497A/R661A/Q695A/K848A/Q926A/K1003A/R1060A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationN497A/R661A/Q695A/K848A/Q926A/K1003A/R1060APromoterCMVAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-NRCH-SsAPOBEC3B
Plasmid#198550PurposeExpresses human codon-optimized SpCas9-NRCH-SsAPOBEC3B and blasticidin resistance: EFS promoter-SpCas9-NRCH-SsAPOBEC3B-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRCH-SsAPOBEC3B
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459v3-eSpCas9(1.1)
Plasmid#178800PurposeHigh-fidelity eSpCas9(1.1) with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-nSpCas9-APOBEC1
Plasmid#209039PurposeLentiviral vector expressing doxycycline-inducible human codon-optimized cytosine base editor where APOBEC1 is fused to the N-terminus of SpCas9(D10A)-sDNA Rad51-2xUGI-6xNLSDepositorInsertAPOBEC1-nSpCas9
UseCRISPR and LentiviralTagsFLAG-HAExpressionMammalianMutationD10APromoterTight TRE promoterAvailable sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-dSpCas9
Plasmid#201953PurposeMammalian expression plasmid of dead SpCas9 with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-dSpCas9-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD10A and H840A on SpCas9PromoterCbhAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPB-spCas9-pNeo
Plasmid#214120PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInsertspCas9
UseCRISPRExpressionMammalianMutationCodon-optimized for mammalian cellsAvailable sinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_CALR sgRNA / hSpCas9
Plasmid#172838PurposeMammalian expression of a sgRNA targeting the intron 1 of CALR (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of CALR under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCASP-SptP120-TD-HilA
Plasmid#153330PurposeTriggers secretion of SptP120 fused to the HA4-7c12 Tandem Monobody from Salmonella upon induction with arabinoseDepositorInsertSptP120-HA4-7c12 Tandem Monobody
UseSalmonella expressionAvailable sinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACYC-OspCas12c-noncoding
Plasmid#120878PurposeExpresses concatenated noncoding sequences surrounding the CRISPR-OspCas12c system in the native genomic loci; expresses the tracrRNA required for activity.DepositorInsertNoncoding sequences for CRISPR-OspCas12
UseCRISPRExpressionBacterialPromoterlacAvailable sinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#3
Plasmid#107731PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#3
Plasmid#107728PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by