We narrowed to 40,299 results for: LAT;
-
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-beta2(616-951)Double
Plasmid#100746PurposeBacterial expression of GST-tagged beta2 subunit of AP2 complex (hinge and ear) long splice form, mutantDepositorInsertAP2B1 (AP2B1 Human)
TagsGSTExpressionBacterialMutationLong isoform with deletion of clathrin binding mo…Available SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-beta2(616-951)∆CBM
Plasmid#100745PurposeBacterial expression of GST-tagged beta2 subunit of AP2 complex (hinge and ear) long splice form, mutantDepositorInsertbeta2 adaptin (AP2B1 Human)
TagsGSTExpressionBacterialMutationLong isoform with deletion of clathrin binding mo…Available SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLuc-OptoJNKi
Plasmid#89744PurposeExpression of light-regulated JNK inhibitor, firefly luciferase-fused, wild-type photosensor, inhibitor JIP11DepositorInsertOptoJNKi
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1-Ins2-842
Plasmid#53969Purpose842 bp insert from mouse Ins2 gene used as a control for methylation-specific PCR assaysDepositorAvailable SinceJuly 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
JA1280
Plasmid#49969PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1272
Plasmid#49967PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1266
Plasmid#49966PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1229
Plasmid#49955PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1217
Plasmid#49954PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGL403
Plasmid#119953PurposeExpresses GPPS and LimS, for the production of GPP and (S)-limonene, in Escherichia coli.DepositorInsertsgpps
limS
ExpressionBacterialMutationN-terminal truncation of 56 amino acid residues (…Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMK262 (RAD21-mAC Neo)
Plasmid#140538PurposeRAD21 tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
CTCF-mAC donor (Hygro)
Plasmid#140646PurposeCTCF tagging with mAID-cloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHRIG-Akt1
Plasmid#53583Purposelentiviral expression of constitutively active human Akt1 and EGFPDepositorInsertcAkt1 (AKT1 Human)
UseLentiviralTagsHA and IRES-EGFPExpressionMammalianMutationconstitutively active (myristoylated version)PromoterCMVAvailable SinceOct. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
CTCF-mAC donor (Neo)
Plasmid#140645PurposeCTCF tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas13-NES-eNAT10
Plasmid#238299PurposeExpresses cytoplasmic version of the programmable RNA acetylation system.DepositorInsertdPspCas13b fused to eNAT10 (NAT10 Prevotella sp. P5-125, Human)
UseCRISPRTagsHIV NES (C terminal of dPspCas13b)ExpressionMammalianMutationH133A for catalytically inactive mutant, deletion…Available SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
DHC1 CRISPR
Plasmid#140545PurposeDHC1 tagging CRISPRDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPRAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPtGE34
Plasmid#107932PurposeExpresses Cas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
UseCRISPR and Synthetic Biology; Episomal vector for…Available SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER-21-RUNX1
Plasmid#97043PurposeExpresses RUNX1 in mammalian cellsDepositorInsertRunt Related Transcription Factor 1 (RUNX1 Human)
UseLentiviralExpressionMammalianPromoterTet onAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMG059 MBP-CREB-His
Plasmid#154076PurposeExpresses MBP-CREB-His (human CREB as a fusion protein with MBP and His- tags) in E.coliDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only