We narrowed to 7,184 results for: RAP
-
Plasmid#207488PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertBATF, HA-GD2-28z_CAR (BATF Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-805_HA-GD2-28z_CAR_BATF-RFP
Plasmid#207492PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertBATF-RFP, HA-GD2-28z_CAR (BATF Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-755_HA-GD2-28z_CAR_RFP-JUN
Plasmid#207494PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertRFP-JUN, HA-GD2-28z_CAR (JUN Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-837_NY-ESO-1_TCR_tFAS
Plasmid#207500PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttFAS, NY-ESO-1_TCR (FAS Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MED13L_COL23A1
Plasmid#205849PurposeExpress mEGFP-tagged fusion protein, MED13L_COL23A1 from patient-derived sequenceDepositorUseTagsmEGFPExpressionMammalianMutationPromoterAvailable sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 5 Spacer
Plasmid#172733PurposeEncodes Part 5 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyTagsExpressionMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterAvailable sinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 4 Spacer
Plasmid#172732PurposeEncodes Part 4 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyTagsExpressionMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterAvailable sinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 3 Spacer
Plasmid#172731PurposeEncodes Part 3 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyTagsExpressionMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterAvailable sinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1 Spacer
Plasmid#172729PurposeEncodes Part 1 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyTagsExpressionMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterAvailable sinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1b Spacer
Plasmid#172728PurposeEncodes Part 1b of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyTagsExpressionMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterAvailable sinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1a Spacer
Plasmid#172727PurposeEncodes Part 1a of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyTagsExpressionMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterAvailable sinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1-5 DO
Plasmid#172726PurposeEncodes a sfGFP dropout expression cassette in place of Parts 1-5 to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseTags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable sinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-LC3B Q116P G120
Plasmid#129290PurposeExpresses GFP-tagged deconjugation-resistant LC3B in mammalian cellsDepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
UseTagsGFPExpressionMammalianMutationChanged Glutamine 116 to Proline. Deleted amino a…PromoterCMVAvailable sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9ExpressionMutationPromoterU6 and CBhAvailable sinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
im:7163548_L (OZ571)
Plasmid#35211DepositorInsertZinc finger array targeting im:7163548 (im:7163548 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceMarch 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
zgc:162148_L (OZ579)
Plasmid#35219DepositorInsertZinc finger array targeting zgc:162148 (micu1 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only