We narrowed to 7,183 results for: lentiviral plasmid
-
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K85R-VA
Plasmid#98691PurposeLentiviral expression of human PRDX5-K85R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK85RPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5E80K-VA
Plasmid#98689PurposeLentiviral expression of human PRDX5-E80K in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationE80KPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K83R-VA
Plasmid#98690PurposeLentiviral expression of human PRDX5-K83R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK83RPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
tetO-ALN
Plasmid#43918DepositorUseLentiviral; Doxycycline inducibleTags6xHis and V5ExpressionMammalianMutationGylcine-serine-glycine (GSG) linker followed by v…PromoterTRE promoter, Tet-ONAvailable SinceMarch 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCDH-SFFV-GLuc-CreERT2-mCherry
Plasmid#178185Purposethe plasmid promotes the constitutive expression of CreERT2 to enable intracellular recombination, Gaussia Luc can be used for in vivo imaging and mCherry is used as a marker for ex vivo analyses.DepositorInsertsGLuc
CreERT2
mCherry
UseLentiviralAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICOZ-MAG[EF1α-CD19 4-1BB-eGFP]
Plasmid#218344PurposeDonor plasmid of MAG Transposon with CD19 CAR mammalian expression cassetteDepositorInsertCD19 CAR mammalian expression cassette
UseLentiviralExpressionMammalianAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_GFP
Plasmid#141210Purposeempty GFP vector for cloning sgRNA or pgRNAsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pICOZ-SB100X[EF1α-CD19 4-1BB-eGFP]
Plasmid#218343PurposeDonor plasmid of SB100X Transposon with CD19 CAR mammalian expression cassetteDepositorInsertCD19 CAR mammalian expression cassette
UseLentiviralExpressionMammalianAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ spike_del19
Plasmid#155297PurposeExpression of spike with C-term deletion of 19 aa, used to generate high efficiency SARS-CoV-2-pseudotyped lentiviral particlesDepositorInsertSARS-Cov2 spike_deleted (S SARS-Cov2)
UseGeneration of sars-cov-2-pseudotyped lentiviral p…MutationDeletion in C-term 19 aa of spikePromoterCMVAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
CROPseq-Guide-Puro
Plasmid#86708PurposeMakes CRISPR gRNAs detectable by single-cell RNA-seq. The gRNA is expressed as part of the puromycin resistance mRNA transcribed by RNA Pol II and in its functional form from the hU6 promoter.DepositorInsertEF1a-Puro-WPRE-hU6-gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-Venus-Akaluc (neo)
Plasmid#124701PurposeAka-Luciferase reporterDepositorInsertVenus-Akaluciferase
UseLentiviralPromoterhPGKAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-mScarlet-Control-5'UTR
Plasmid#184637PurposeFluorescent reporter for mammalian cells: Expression of mScarlet with a CMV 5'UTRDepositorInsertmScarlet
UseLentiviralExpressionMammalianAvailable SinceJune 2, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
p-EF1a-CreERT2-3Xflag-T2A-eBFP2
Plasmid#170186PurposeThis Cre-ERT2 expressing construct can be used to inducibly recombine loxp sites. It can be used with poly-loxP containing plasmids to generate timestamp barcodes useful for linage tracingDepositorInsertCreERT2-T2A-eBFP2
UseLentiviralPromoterEF1 alphaAvailable SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
YAP/TAZ-TRE-mStrawberry reporter
Plasmid#158682PurposeThis plasmid is a YAP/TAZ pathway reporter. It has a YAP/TAZ-responsive synthetic promoter driving the expression of mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiRNACRISPR_005 - hU6-DR_BsmBI-EFS-RfxCas13d-NLS-2A-Puro-WPRE
Plasmid#138147PurposeExpresses RfxCas13d in mammalian cells, localized in the nucleus. For cloning of guide RNAs compatible with RfxCas13d. Contains a 5' direct repeat. Clone using BsmBI. F overhang aaac. R overhang aaaaDepositorInsertCasRx
UseLentiviralTagsNLSAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-EcSTH-FLAG
Plasmid#218628PurposeThis plasmid contains human codon optimized sequence of EcSTH which is a soluble transhydrogenase from E. coli that can be used to increase NADH/NAD+ ratio in mammalian cells.DepositorInsertEcSTH
UseLentiviral and Synthetic BiologyTagsFLAGExpressionMammalianAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only