We narrowed to 5,264 results for: crispr cas9 expression plasmids
-
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-dgRNA-CAG-MPH
Plasmid#106259PurposeExpresses MPH co-activator from the CAG promoter and one U6-driven dgRNA in AAV backboneDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Neo-CAG-Flpe-ERT2
Plasmid#68460PurposeAAVS1 targeting donor plasmid with Flpe-ERT2 expression cassette and Neo selection geneDepositorInsertmammalian-codon-optimized Flpe recombinase fused with ERT2
UseSynthetic BiologyTagsERT2ExpressionMammalianPromoterCAGAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60228PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA control targeting LacZ. AAV backbone.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Blasticidin-CAG-Flpe-ERT2
Plasmid#68461PurposeAAVS1 targeting donor plasmid with Flpe-ERT2 expression cassette and blasticidin selection geneDepositorInsertmammalian-codon-optimized Flpe recombinase fused with ERT2
UseSynthetic BiologyTagsERT2ExpressionMammalianPromoterCAGAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX601-mCherry
Plasmid#84039PurposeStaphylococcus aureus (SaCas9) conjugated with mCherryDepositorInsertSaCas9
UseAAV and CRISPRTagsNLS and T2A-mCherryExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Simple-gRNA backbone
Plasmid#51306PurposegRNA expression plasmidDepositorTypeEmpty backboneUseCRISPR; Xenopus expressionPromoterT7Available SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJW1285
Plasmid#61252PurposeCRISPR/Cas9 plasmid with sgRNA(F+E) targeting pha-1; for co-conversion in C. elegansDepositorInsertsgRNA(F+E) targeting pha-1
UseCRISPRExpressionWormAvailable SinceDec. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
eGFPbait-E2A-KalTA4-pA donor vector
Plasmid#61069Purposefor CRISPR/Cas9 mediated insertion of E2A-KalTA4; to be used in combination with a eGFP specific sgRNA (e.g. Plasmid 61051)DepositorInsertseGFPbait
KalTA4
UseZebrafish expressionTagsE2AAvailable SinceFeb. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001148862)
Plasmid#80263Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP1673
Plasmid#65769PurposeBacterial expression plasmid for S. thermophilus1 Cas9 & sgRNA (need to clone in spacer into BspMI sites): T7-humanSt1Cas9-NLS-T7-BspMIcassette-St1-sgRNADepositorInsertmammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS, and St1Cas9 gRNA
UseCRISPRTagsNLSExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-i53
Plasmid#92170Purposerecombinant adeno-associated viral plasmid for delivery and expression of ubiquitin variant (i53) that is a selective inhibitor of 53BP1DepositorInserti53
UseAAVTagsFLAGExpressionMammalianMutationUbvG08 with I44A mutation and no terminal GlycinesPromoterCMVAvailable SinceJuly 13, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
EGFP gRNA (BRDN0000563266)
Plasmid#80036Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pS34.EF1α<GFP-2A-Cas9-RC
Plasmid#207404PurposeCas9-RC and GFP from an EF1α promoter. High-performance knockin through DSB repair by homology-directed recombination (HDR) or homology-mediated end joining (HMEJ). [Lab plasmid ID: N213]DepositorInsertCas9-RC
UseCRISPR and Synthetic BiologyTagsGFP-2AExpressionMammalianPromoterEF1αAvailable SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP12-AAV-H1/TO-L-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82704PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001149198)
Plasmid#80248Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right}
Plasmid#184381PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, two gRNAs targeting dystrophin
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMART-sgRNA (Sp)
Plasmid#80427PurposeU6 promoter driven sgRNA expression plasmid. Annealed oligonucleotides encoding crRNA sequence are ligated into BbsI site.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only