We narrowed to 10,315 results for: plasmids 101
-
Plasmid#236862PurposeExpress NanoLuc(R)-NRAS (Q61R)-CRAF RBD-HaloTag(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAUseTagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationQ61RPromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
MIP 247 CoMiP 4in1 with shRNA p53
Plasmid#63726PurposeTo express Oct4, Klf4, Sox2, c-Myc and hairpin RNA p53. A single plasmid reprogramming system using a mini-intronic plasmid (MIP).UseTagsIRES-dtomatoExpressionMammalianMutationcodon-optimisedPromoterSFFV for Pct4, Klf4, Sox2 and c-myc; U6 for p53Available SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJB94
Plasmid#208752PurposeTheophylline-based control of repA on a C. difficile plasmid for use in allelic exchangeDepositorAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
H2A-HaloTag/CMV Vector
Plasmid#238747PurposeExpress H2A-HaloTag Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertH2A (H2AC20 Human)
UseTagsHaloTag (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Fon/ConN2cG
Plasmid#234709PurposepAAV transfer plasmid with Ef1a promoter driving Cre- and Flp-dependent expression of G protein for rabies N2c delta GDepositorInsertFon Con N2cG
UseAAVTagsExpressionMammalianMutationPromoterEf1aAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDZ2FE_Champ1_1-812
Plasmid#105675PurposeExpresses Flag-tagged full-length human Champ1 proteinDepositorAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
BMP2K
Plasmid#73251PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertBMP2KA (BMP2K Human)
UseTagsHis6-Zb-TEVExpressionBacterialMutationpfam00069:Pkinase 52-311PromoterT7Available SinceApril 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGLIS3-donor
Plasmid#113812PurposeCRISPR donor plasmid to tag human transcription factor GLIS3 with GFPDepositorInsertGLIS3 homology arms flanking EGFP-IRES-Neo cassette (GLIS3 Human)
UseCRISPRTagsExpressionMutationrs10118031, rs10973702, rs912257PromoterAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRW398-URA3-BXB1-LP
Plasmid#235977PurposePlasmids for generation of donor DNA for construction of a BXB1-compatible landing pad p1 with URA3 selection marker.DepositorInsertURA3
UseTagsExpressionMutationPromoterAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SARS-CoV-2 SL1 alone-Luciferase
Plasmid#191482PurposeLuciferase reporter for SARS-CoV-2 5' UTR SL1 aloneDepositorInsertSARS-CoV-2 5' UTR SL1 alone
UseLentiviral and LuciferaseTagsExpressionMutationContains only the stem-loop1 region of SARS-CoV-2…PromoterAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-SARS-CoV-2 5’UTR ΔSL1-Luciferase
Plasmid#191481PurposeLuciferase reporter for SARS-CoV-2 5' UTR ΔSL1DepositorInsertSARS-CoV-2 5' UTR ΔSL1
UseLentiviral and LuciferaseTagsExpressionMutationMissing the stem-loop 1 region of SARS-CoV-2 5…PromoterAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pANG03
Plasmid#178085PurposeTetracycline resistant backbone for in vivo Gateway reaction. Plasmid contains gateway cassette with restriction sites to add promoters or C and N Terminal tags. Compatible with pANG02.DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterNAAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pANG01
Plasmid#178083PurposeCarbenicillin resistant backbone for in vivo Gateway reaction. Plasmid contains gateway cassette with restriction sites to add promoters or C and N Terminal tags. Compatible with pANG02.DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterNAAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCW-SPI1
Plasmid#162824PurposeDoxycycline-inducible overexpression of human SPI1DepositorAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pANG02
Plasmid#178084PurposeGentamycin resistant backbone for in vivo Gateway reaction. Plasmid contains gateway cassette with restriction sites to add promoters or C and N Terminal tags. Compatible with pANG01 or pANG03.DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterNAAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
T4 Lysozyme I3A
Plasmid#18200DepositorAvailable SinceAug. 26, 2008AvailabilityAcademic Institutions and Nonprofits only -
T4 Lysozyme I3P
Plasmid#18211DepositorAvailable SinceAug. 26, 2008AvailabilityAcademic Institutions and Nonprofits only -
T4 Lysozyme I3Y
Plasmid#18215DepositorAvailable SinceSept. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
T4 Lysozyme I3C
Plasmid#18201DepositorAvailable SinceAug. 26, 2008AvailabilityAcademic Institutions and Nonprofits only