We narrowed to 9,972 results for: crispr plasmids
-
Plasmid#161520PurposeGateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zSpRYCas9-NLS without promoterDepositorInsertzSpRYCas9
UseCRISPR; Gateway compatible zsprycas9 entry cloneTags3X FLAG, NLS and NLSExpressionPlantAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-GG-OCT4-1-5-PGK-Puro
Plasmid#102893PurposePiggyBac transposon system construct with 5 concatenated U6 promoter driven transcriptional cassettes for the activation of OCT4. Contains PGK-puro selection cassette.DepositorAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-AID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187960PurposeAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-mAID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187963PurposemAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertsAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linker and T2AExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP311-pAAV-EFS-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113688PurposeSaCas9 driven by EFS. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfb-g1)-PGKpuroBFP-W
Plasmid#105023PurposeLentiviral gRNA plasmid targeting mouse Nelfb , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfb-g2)-PGKpuroBFP-W
Plasmid#105024PurposeLentiviral gRNA plasmid targeting mouse Nelfb , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
SFFV-ZIM3-dCas9-2A-mCherry
Plasmid#251398PurposeLentiviral expression plasmid of ZIM3-dCas9 with mCherryDepositorInsertZIM3 (ZIM3 Synthetic)
UseCRISPR and LentiviralTagsFLAG and mCherryExpressionMammalianMutationIncludes ZIM3 aa 1-100PromoterSFFVAvailable SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pS12<ActB.mus_2A-mCh_KI-HMEJ
Plasmid#207407PurposeDonor template to knock in mCherry at the C-terminus of mouse ActB (β-Actin) using DSB repair by homology-mediated end joining (HMEJ). [Lab plasmid ID: TU148]DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUBI-RZ-Cas12j2
Plasmid#189781PurposeCas12j2 (CasΦ) Gateway gRNA entry plasmid using Zea mays Ubi promoter and HH, HDV ribozyme processingDepositorInsertgRNA cloning site
UseCRISPRAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Hgs-g1)-PGKpuroBFP-W
Plasmid#105032PurposeLentiviral gRNA plasmid targeting mouse Hgs , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterU6 and synthetic Probasin ARRx2Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSL1765 (pSPIN-R, R*MmeI)
Plasmid#160734PurposeSingle-plasmid V. cholerae CAST. Encodes all proteins, crRNA, donor DNA; non-targeting crRNA with BsaI sites. Reverse (R) order minimizes self-targeting; MmeI site for Tn-seq; pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpCas9-GFP-U6-gRNA
Plasmid#79144PurposeAll-in-one CRISPR/Cas9 vector with CAG promoter for expression in human ESC/iPSCDepositorInsertSpCas9
UseCRISPRTags2A-GFPExpressionMammalianPromoterCAGAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGabrg2
Plasmid#124857PurposeMutagenesis of Gabrg2DepositorInsertGabrg2 (Gabrg2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc17a6
Plasmid#124847PurposeMutagenesis of Slc17a6 with SauCas9DepositorInsertSlc17a6 gRNA (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSECC
Plasmid#60820Purpose3rd generation vector. Expresses a sgRNA of interest, Cas9 and CreDepositorInsertsCas9
Cre
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingTagsFlagExpressionMammalianMutationBsmBI site eliminated by C->A; E308GPromoterEFS and EFS (after Cas9-2A)Available SinceNov. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -