We narrowed to 10,767 results for: yeast
-
Plasmid#46791PurposeTo express a version of Fun30 without CUE domain in budding yeastDepositorAvailable sinceAug. 8, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pFA12
Plasmid#46792PurposeTo express a version of Fun30 with a mutated CUE domain in budding yeastDepositorAvailable sinceAug. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB2903(XI-2 MarkerFree)
Plasmid#73275PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XI-2 (Chr XI: 91575..92913)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCfB2899(X-2 MarkerFree)
Plasmid#73271PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site X-2 (Chr X: 194944..195980)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
p4A8_S7T_BC
Plasmid#217832Purpose4A8 variant in barcoded, yeast surface display plasmidDepositorInsert4A8 variant Fab
ExpressionYeastMutationVL: S7TAvailable sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD_kappa_mRFP
Plasmid#217830PurposeYeast surface display Fab vector with kappa light chain and mRFPDepositorTypeEmpty backboneExpressionYeastAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMG
Plasmid#138264PurposeYeast intergration vector for integration of dual reporter system at the URA3 locus. Dual reporter system contains constitutive mCherry and constitutive eGFP flanked by iCas9 sites.DepositorInsertseGFP flanked by iCas9 sites
mCherry
UseCRISPRExpressionYeastPromoterTef1Available sinceMarch 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLLX8
Plasmid#79838PurposeContains yeast counter selectable marker, CYH2, and ampicillin resistance cassette, used for making a DNA capture vectorDepositorTypeEmpty backboneUseContains yeast counter selection gene, cyh2 and b…Available sinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Designed VEGF-binding scFv G6des13
Plasmid#110213PurposeYeast Surface Display of G6des13DepositorInsertG6des13
Tagscmyc tagExpressionYeastMutationL A43P, L Q89L, L T94D, L P95T, H Y59H, H Y95FAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSc-His6-Sem1Sc
Plasmid#83235PurposepGREG600-His6-Sem1Sc, Expresses the His6-Sem1 in yeastDepositorAvailable sinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYDS2.0_AT118-L
Plasmid#222847PurposeYeast-display plasmid encoding Nb. AT118-L, a humanized nanobody antagonist of the human Angiotensin II type I receptor (AT1R) with reduced polyreactivityDepositorInsertAT118-L
ExpressionYeastAvailable sinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXNgate22-1HA
Plasmid#105077PurposeYeast mating-based Split Ubiquitin Assay, prey vector for in vivo cloningDepositorTypeEmpty backboneTagsNubGExpressionYeastAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJK-caCas9-NatMX-Neut5L-Leu2 drive
Plasmid#89578PurposecaCas9 integrating vector into the Neut5L locus with gene drive for targeting Leu2 locusDepositorInsertLeu2 gene drive
ExpressionYeastAvailable sinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan-ADE2
Plasmid#232105PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan
Plasmid#232099PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with KanMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Nat-ADE2
Plasmid#232103PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg
Plasmid#232098PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with HygMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only