We narrowed to 7,068 results for: poly
-
Plasmid#236005PurposeEndosome-targeted inositol polyphosphate 5 phosphatase (INPP5E); hydrolyzes 5-phosphate in PI(3,4,5)P3 and PI(4,5)P2.DepositorInsertEndo-INPP5E (INPP5E Synthetic, Human)
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger) and mChe…ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ratiometric FPX sensor for ERK kinase activity
Plasmid#60974PurposeFor imaging of ERK kinase activity using a single polypeptide RA-WW domain-ERK substrate-B protein and free GA-NES.DepositorInsertddRFP A-WW domain-ERK substrate-ddFP B
TagsERK substrate is before ddFP copy B, WW domain is…ExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHIV-EGFP.Flag-EZH2
Plasmid#220243PurposeExpresses wild-type EZH2 for knockout/rescue experiments in mammalian cells.DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLJM1 flag-cFLIP
Plasmid#211529PurposeExpresses flag-tagged cFLIP (CFLAR)DepositorAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-WPRE-SV40-pA (JDW 922)
Plasmid#224545PurposeA Gateway compatible 3' entry clone containing a woodchuck herpes simplex virus regulatory element (WPRE) to stabilize mRNA upstream of an SV40 polyADepositorInsertWPRE-SV40-pA
UseGateway CloningAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
MOM603
Plasmid#133242Purposeexpresses full-length human KIF1A fused with mScarlet and StrepII tag in insect cellsDepositorInsertkif1a (KIF1A Human)
TagsStrepII tag and mScarletExpressionInsectPromoterpolyhedrin promoterAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.MTF2
Plasmid#125169PurposeExpresses human MTF2 in insect cells, under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAc-C Med12His
Plasmid#49240Purposeexpresses human Med12 with His tag in insect cellsDepositorAvailable SinceNov. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
HAP40 1-371
Plasmid#124060PurposeBaculovirus expression vector for HAP40 protein (aa 1-371) in insect cellsDepositorInsertHAP40 (F8A1 Human)
UseBaculovirus expressionTags6x His and TEV cleavage sitePromoterpolyhedrinAvailable SinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-FLTID-GSQ-RBXN-P2A-BLAST
Plasmid#208041PurposeEnables constitutive expression of TurboID alone; RBXN represents a EcoR1-BsiW1-Xba1-Not1 polylinker; selection with blasticidinDepositorInsertTurboID
UseLentiviralPromoterEFSAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFPZNF598-9P-9A
Plasmid#141192PurposeExpresses GFP-ZNF598 mutated in polyproline streches in mammalian cells, can be used to make inducible cell lineDepositorInsertZNF598 (ZNF598 Human)
TagsGFPExpressionMammalianMutationall 3 proline repeats are mutated to Alanine (9xP…PromoterCMVAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.PHF1
Plasmid#125167PurposeExpresses human PHF1 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT14-pDEST10
Plasmid#118382PurposeHIS-tagged insect cell expression vector with KAT14.DepositorAvailable SinceMay 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1 human full-length CENP-E-mNeon-6xHis
Plasmid#180484PurposepFastBac1 human CENP-E-mNeon-His, containing a 3c protease cleavage site between mNeon and His tag. Codon optimized for expression in Sf9 cellsDepositorInsertCENP-E (CENPE Synthetic, Human, human)
TagsmNeon-6xHisExpressionInsectPromoterpolyhedrin promoterAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shLuc.mKO2
Plasmid#85224PurposeshLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.DepositorInsertFirefly Luciferase
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFB-GST-IRP2
Plasmid#226621PurposeExpresses human IRP2 in insect cellsDepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
MmEos3.2
Plasmid#203754PurposeEncodes the membrane anchor of Src including the first 15 resideues of the N terminus, with 1 myristoylation and short polybasic sequence, with mEos3.2 fused to the C terminus. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFAST-BAC BAF57/SMARCE1-His
Plasmid#177861PurposeTransfer vector to generate recombinant baculovirus expressing BAF57/SMARCE1-His proteinDepositorInsertSMARCE1 (SMARCE1 Human)
TagsHis tag at C-terminus with GGGGS linkerExpressionInsectPromoterpolyhedrinAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-FRT3-stop-FRT-LexGAD-FRT3-Gal4 attB
Plasmid#52890Purpose"CoinFLP-LexGAD/Gal4" - Expresses LexGAD or Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express LexGAD, or FRT3-FRT3 pair to express Gal4.DepositorInsertsExpressionInsectAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only