We narrowed to 7,824 results for: ski
-
Plasmid#82891PurposeGateway Donor vector containing CCND1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pAAV.CAG.iAChSnFR-NULL
Plasmid#137956PurposeExpresses iAChSnFR (non-binding variant) under CAG promoterDepositorArticleInsertiAChSnFR (non-binding variant)
UseAAVExpressionMammalianMutationY140A binding site mutantPromoterCAGAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP-hTRF1
Plasmid#103802PurposeBLInCR 'Localizer' construct that marks the telomeres and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PIH1D1_WT_V5
Plasmid#82943PurposeGateway Donor vector containing PIH1D1, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6p-1_GST-DmKHC[1-421]_1xmNeonGreen
Plasmid#196974PurposeBacterial expression plasmid for GST-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with C-terminal mNeonGreen tag and cleavable N-terminal GST tagDepositorAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RNH1_WT_V5
Plasmid#82995PurposeGateway Donor vector containing RNH1, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgRANGAP.C1-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216249PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and sgRANGAP.C1 to tag endogenous RANGAP1 C-terminusDepositorInsertCas9 and sgRANGAP.C1 (RANGAP1 Human)
UseCRISPR; Endogenous taggingExpressionMammalianPromoterCAGAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_EGFR_p.D837A
Plasmid#82912PurposeGateway Donor vector containing EGFR, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-FTO promoter_WT
Plasmid#108922PurposeThe core promoter region of FTO was inserted into pGL3 basic vectorDepositorAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000338399
Plasmid#78156PurposeshXPO1 targeting CDSDepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_CCL2_WT_V5
Plasmid#82935PurposeGateway Donor vector containing CCL2, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
t1-405
Plasmid#166127PurposeFor expression of human talin-1 head (residues 1-405) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1Head (1-405) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
FFSS-Cyclin D1-NeoR
Plasmid#215087PurposeExpresses FFSS-Cyclin D1 in mammalian cells.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-HEK3-CTTins-px330-scaffold
Plasmid#180017PurposeTransiently expressing a pegRNA to introduce HEK3 CTT insertion in human cells. It has a sgRNA scaffold from px330.DepositorInsertPrime editing pegRNA for HEK3-CTTins, with px330 scaffold (EPHA8 Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KEAP1_p.G524C
Plasmid#82779PurposeGateway Donor vector containing KEAP1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-FTO promoter_Mut
Plasmid#108923PurposeThe core promoter region of FTO with mutant CEBPA binding sites was inserted into pGL3 basic vectorDepositorAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_CGREF1_WT
Plasmid#82895PurposeGateway Donor vector containing CGREF1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-RAP1A-WT-neo
Plasmid#156173PurposeLentiviral vector for expression of RAP1A-WT, with neomycin sectionDepositorInsertRAP1A (RAP1A Human)
UseLentiviralTagsnoneExpressionMammalianMutationwild type formPromoterhuman PGKAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQC hGAB.wt V5-His IRES G418
Plasmid#110333PurposeMammalian retroviral expression of glutaminase 2 isoform GAB (wild type) with V5 and 6xHis tagsDepositorInsertGLS2 Glutaminase 2 (GLS2 Human)
UseRetroviralTags6xHis and V5ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only