We narrowed to 15,270 results for: grn
-
Plasmid#234736PurposePseCAST crRNA targeting hROSA26-1, with 1 kb donor transposonDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthROSA26-1 crRNA
ExpressionMammalianAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E4orf6
Plasmid#64220PurposeExpression vector for sgRNA and Cas9 linked via T2A to BFP linked to the Ad4 E4orf6 gene via P2ADepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E4orf6ExpressionMammalianPromoterCBh and U6Available sinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLB2 Ubi-FLIP FF
Plasmid#19753DepositorInsertoligo targeting Firefly luciferase
UseCre/Lox, Lentiviral, Mouse Targeting, and RNAiExpressionMammalianAvailable sinceDec. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable sinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti-sgRNA(MS2)-puro-barcode
Plasmid#89493PurposeCloning backbone for sgRNA, also has a barcode that allows detection from scRNA-seqDepositorInsertsgRNA (with MS2 loop)
UseLentiviralPromoterU6Available sinceJune 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-dSaCas9-VP64-pU6-sgRNA
Plasmid#158990PurposeVector G encodes pAAV-pCMV-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in mammalian cellsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpCMVAvailable sinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable sinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiCRISPR_DKO
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available sinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-flex-dsRed-shvgat
Plasmid#67845PurposeExpresses shRNA to the vesicular GABA transporter VGAT. Cre dependent expression by flex switchDepositorInsertAAV-hsyn-flexed-dsRed-miR30-vgat2.shRNA
UseAAV, Cre/Lox, Mouse Targeting, and RNAiExpressionMammalianPromoterh-synapsinAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pL-CRISPR.EFS.PAC
Plasmid#57828PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP
Plasmid#188899PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLS, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS, P2A-GFP, and Zim3 KRAB-NLS fusionPromoterSFFVAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO human shRNA 1 DEPTOR
Plasmid#21335DepositorAvailable sinceJuly 6, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKLV2-U6gRNASAM(gTetO)-TREGFP-PGKpuroBFP-W
Plasmid#112927PurposeCRISPR-a reporter assay lentiviral vector (gTetO)DepositorInserthU6-gRNASAM(gTetO), TREGFP, PGKpuroGFP
UseCRISPR and LentiviralExpressionMammalianAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_22A
Plasmid#91133PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: 2x35S:npt IIDepositorInsertEngineering Reagent: 35S:AtCas9 + AtU6:gRNA
UseCRISPRExpressionPlantAvailable sinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GAG-CRErec
Plasmid#119971PurposeExpresses GAG (FMLV) fused with CRE recombinase for the production of VLPs loaded with CRE proteinDepositorInsertGAG-nlsCRErec
TagsnlsExpressionMammalianPromoterhCMVAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSicoR human DGCR8-1
Plasmid#14769DepositorAvailable sinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-pMecp2-dSaCas9-KRAB-pU6-sgRNA
Plasmid#158988PurposeVector E encodes pAAV-pMecp2-dSaCas9-KRAB-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-KRAB
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available sinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shBRCA1 #1
Plasmid#44594DepositorAvailable sinceMay 7, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBLO 62.5
Plasmid#123124PurposeHuman expression vector for planctomyces CasX and sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCasX protein
CasX sgRNA
UseCRISPRExpressionMammalianAvailable sinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSUPER.ATRi
Plasmid#14582DepositorPublicationAvailable sinceMarch 27, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by