We narrowed to 13,031 results for: Hal
-
Plasmid#129204PurposeyTRAP sensor of [RNQ+], detects aggregation of Rnq1DepositorAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pNH13 (pmyo-2::QuasAr::mOrange)
Plasmid#130273PurposeExpresses the eFRET-based voltage sensor QuasAr::mOrange in the pharynx of C. elegans.DepositorInsertQuasAr::mOrange
TagsmOrangeExpressionWormAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGAN200
Plasmid#129203PurposeyTRAP sensor of [PSI+], detects aggregation of Sup35DepositorInsertSup35NM (SUP35 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationN terminal and middle domainsPromoterSUP35Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK267
Plasmid#129272Purpose"ZF only" yTRAP control to control for yTRAP reporter fluorescence changes not dependent on sensed proteinDepositorInsertNLS-VP16-ZF 43-8-NES
Tags6xHAExpressionYeastPromoterSUP35Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE-mRuby3
Plasmid#214923Purposeexpression vector control - contitutive expression of mRuby33 aloneDepositorInsertmRuby3
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
HSPD1-i7 -HT2
Plasmid#236333PurposeInducibly expresses HSPD1 tagged with HaloTag2 at the relative location of intron 7 in the HSPD1 gene.DepositorAvailable SinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
CALR-i2-HT2
Plasmid#236334PurposeInducibly expresses CALR tagged with HaloTag2 at the relative location of intron 2 in the CALR gene.DepositorInsertCALR (CALR Human)
UseLentiviralTagsHaloTag2 internal insertion at intron 2ExpressionMammalianAvailable SinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
EPHA2-i16-HT2
Plasmid#236335PurposeInducibly expresses EPHA2 tagged with HaloTag2 at the relative location of intron 16 in the EPHA2 gene.DepositorInsertEPHA2 (EPHA2 Human)
UseLentiviralTagsHaloTag2 internal insertion at intron 16ExpressionMammalianAvailable SinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
-
pHD57 [Tol2-UAS:sypb-egfp-cry2-polyA]
Plasmid#198381PurposeExpression of SYPB::CRY2olig(535) in neurons of Danio rerioDepositorInsertUAS:sypb-egfp-cry2
UseTol2TagsEGFPMutationD387APromoterUASAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pADH99Cau
Plasmid#244807PurposeModified plasmid from pADH99 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertCauHIS1_US
UseCRISPRTagsC. albicans MAL2 promoter, C. albicans codon opti…ExpressionYeastAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
MuHKI-pGFPN3
Plasmid#21919DepositorInsertMutant huamn HKI (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK1 Human)
TagsGFPExpressionMammalianMutationThis is the full length human HKI cDNA sequence w…Available SinceNov. 2, 2009AvailabilityAcademic Institutions and Nonprofits only -
ATG-1929
Plasmid#108712PurposeCBR2opt in pF4Ag expression vector with T7 and CMV promoterDepositorInsertCBR2opt
ExpressionBacterial and MammalianMutationPromega used directed evolution to create CBR (Cl…PromoterT7, CMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
sh-SRF
Plasmid#100797Purposeexpression of shRNA targeting SRFDepositorInsertrat SRF
UseRNAiPromoterH1Available SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEG302_dCAS9-MQ1(C141S,S317A)_g4+g10+g18
Plasmid#172317PurposeCRISPR dCas9 directly fused to a catalytic inactive version of bacterial DNA methyltransferase MQ1 to target to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(C141S,S317A)_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
JEV-ED3
Plasmid#251259PurposeTo express the Japanese encephalitis virus envelope protein domain III in E. coliDepositorInsertJEV-ED3
Tags6xHis, 11 aa linker, thrombin cleavage siteExpressionBacterialAvailable SinceApril 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
JEV-ED3_C5I
Plasmid#251260PurposeTo express the Japanese encephalitis virus envelope protein domain III with a five-isoleucine tag at the C-terminus in E. coliDepositorInsertJEV-ED3_C5I
Tags5xIle with a GG linker and 6xHis, 11 aa linker, t…ExpressionBacterialAvailable SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA1
Plasmid#166889PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA3
Plasmid#166909PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB17 (punc-17::QuasAr)
Plasmid#214888PurposeExpresses the voltage sensor QuasAr2 in cholinergic neurons of C. elegans.DepositorInsertQuasAr2
ExpressionWormAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-SRRD-mRuby3
Plasmid#214920Purposeinducible expression of SRRD tagged on C-terminus with mRuby3DepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-noTag (in pLEX_307)
Plasmid#214919Purposeconstitutive expression of SRRD with no tag - used as control for SRRD-HA expressionDepositorInsertSRRD (SRRD Human)
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-HA (in pLEX_307)
Plasmid#214918Purposeconstitutive expression of SRRD tagged with HADepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEE071
Plasmid#176828PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert710
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEE073
Plasmid#176830PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert712
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEE074
Plasmid#176831PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert713
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
VV017: Archaerhodopsin-3 w/ D95Q point mutation fused to eGFP
Plasmid#58490PurposeExpresses Arch(D95Q)-eGFP in mammalian cells as a fluorescent reporter of membrane voltageDepositorInsertArchaerhodopsin-3 w/ D95H point mutation fused to eGFP
UseLentiviralTagseGFPExpressionMammalianMutationChanged Aspartic Acid 95 to GlutaminePromoterUbiquitinAvailable SinceAug. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
ATG-2460
Plasmid#108713PurposeEF1-CBR2opt-T2A-copGFP (construct used for lentiviral transduction)DepositorInsertCBR2opt-copGFP fusion
UseLentiviralTagsCBR2opt fused to copGFPMutationPromega used directed evolution to create CBR (Cl…Promoterelongation factor-1Available SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIRESN2 H2B-GFP-uvr8at(2x)
Plasmid#44970DepositorTagsinternal GFPExpressionMammalianMutationtandem repeat of UVR8 (both have Methionine 1 del…PromoterpCMV IEAvailable SinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-V5-APEX2 (in pLEX_307)
Plasmid#214921Purposeconstitutive expression of SRRD fused to V5 and APEX2 - used for APEX2 proximity biotinylationDepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
UPF1-N-term-AID-V5-P2A-Hygro
Plasmid#251490PurposeAID N-terminal UPF1 targeting vectorDepositorInsertHomology arms for N-terminal targeting of UPF1 with AID-Hygro cassette
Tagsauxin-induced degron tagExpressionBacterialAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUPF1-N-term-AID-V5-P2A-BSD
Plasmid#251489PurposeAID N-terminal UPF1 targeting vectorDepositorInsertHomology arms for N-terminal targeting of UPF1 with AID-BSD cassette
Tagsauxin-induced degron tagExpressionBacterialAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
NST1_pOpOn2.1
Plasmid#228065PurposeExpresses NST1 in different cell types in Arabidopsis thaliana upon induction with dexamethasone.DepositorInsertNAC SECONDARY WALL THICKENING PROMOTING FACTOR1, NST1 (NST1 Mustard Weed)
UseDexamethasone inducible vectorExpressionPlantPromoterCaMV35S for LhGR and pOp6-minimal CaMV35S for NST1Available SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
NST3_pOpOn2.1
Plasmid#228066PurposeExpresses NST3 in different cell types in Arabidopsis thaliana upon induction with dexamethasone.DepositorInsertNAC SECONDARY WALL THICKENING PROMOTING FACTOR3, NST3 (NAC012 Mustard Weed)
UseDexamethasone inducible vectorExpressionPlantPromoterCaMV35S for LhGR and pOp6-minimal CaMV35S for NST3Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDV18 [punc-47::SNG-1::CRY2olig(535)]
Plasmid#197598PurposeExpression of SNG-1::CRY2olig(535) in GABAergic motor neurons of C. elegansDepositorExpressionWormMutationE490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV12 [psng-1::SNG-1::CRY2olig(535)]
Plasmid#197596PurposePan-neuronal expression of SNG-1::CRY2olig(535) in neurons of C. elegansDepositorExpressionWormMutationE490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only