We narrowed to 12,071 results for: shRNA
-
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHB
Plasmid#177981Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHBDepositorInsertsgRNA targeting SDHB (SDHB Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CDK5RAP2-SVA-BFP
Plasmid#202824PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CDK5RAP2 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within CDK5RAP2 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgCIC-2
Plasmid#74959PurposeCas9 + sgCIC-2 with blasticidin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7820 pHR (hU6-crPURI-EFS-PuroR-WPRE)
Plasmid#214883PurposeLentiviral vector encoding RfxCas13d targeting PURI guide arrayDepositorInserthU6-crPURI-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7854 pHR (hU6-crGLY-EFS-PuroR-WPRE)
Plasmid#214884PurposeLentiviral vector encoding RfxCas13d targeting GLY guide arrayDepositorInserthU6-crGLY-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDF0338 pAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
Plasmid#172514PurposeEncodes HvsCas7-11 DR and golden gate site for spacer clonings in an AAV backbone with U6 promoterDepositorInsertpAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
UseAAVAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Clta KI
Plasmid#131483PurposeEndogenous tagging of Clathrin light chain α: N-terminal (amino acid position: M1)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pLenti-Blast-sgNT
Plasmid#138678PurposeExpresses a Non-targeting sgRNA and Cas9DepositorInsertsgNT
UseLentiviralPromoterhU6Available SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEB1N-LZ-LOV2(wt)
Plasmid#107614PurposeN-terminal half of π-EB1 with wild-type LOV2, no fluorescent tagDepositorInsertMAPRE1 (MAPRE1 Human)
TagsA. sativa phototropin 1 LOV2 domain and GCN4 leuc…ExpressionMammalianMutationEB1 aa 1-185; resistant to EB1 shRNA#3 (Addgene #…PromoterCMVAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro(PX459)-GJA1 sgRNA
Plasmid#164471PurposeExpresses sgRNA targeting human GJA1 locusDepositorAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPv2_AAVS1
Plasmid#184487PurposeLentivirus all in one CRISPR vector targeting human AAVS1 geneDepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_U6_sgRNA_Mettl3C
Plasmid#165420PurposesgRNA construct for targeting Mettl3 C-terminusDepositorAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
PRKCE gRNA (BRDN0001148049)
Plasmid#76791Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pORANGE CACNG8-GFP KI #2
Plasmid#131474PurposeEndogenous tagging of Tarpγ8: Intramolecular (amino acid position: A408)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145598)
Plasmid#80173Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_v2_Dual_epegRNA_tevopreQ1
Plasmid#187456PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4_v2 optimized epegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R_v2 epegRNA (tevopreQ1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (GAPDH)
Plasmid#180183PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only