We narrowed to 7,672 results for: CCH
-
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S293D
Plasmid#115194PurposeLentiviral transduction and expression of PDHA2S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D/S293D
Plasmid#115195PurposeLentiviral transduction and expression of PDHA2S291D/S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET15b p97-Strep-His E314Amb
Plasmid#169021PurposeExpresses p97-Strep-His E314Amb (incorporates noncanonical amino acid at position 314 via amber suppression) in bacteriaDepositorInsertp97
TagsHis and SBPExpressionBacterialMutationE314TAGPromoterT7Available SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-MIOX
Plasmid#166680PurposeYeast integrative plasmid for expressing deltaVP1 (GAL1 promoter) and mouse myo-inositol oxygenase tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-MIOX
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
wtVP1 + VP2C-GFP
Plasmid#166674PurposeYeast integrative plasmid for expressing wild-type Murine polyomavirus VP1 (GAL1 promoter) and GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFP
Wild-type Murine polyomavirus VP1
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] K683E, H685E, K686E-Ss(424)
Plasmid#166855PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in K683E, H685E, K686E with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
Tags6xHisExpressionYeastMutationK683E, H685E, K686EPromoterpCuAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] F641E, I645E-Ss(424)
Plasmid#166854PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in F641E, I645E with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
Tags6xHisExpressionYeastMutationF641E, I645EPromoterpCuAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] F641G, I645G-Ss(424)
Plasmid#166853PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in F641G, I645G with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
Tags6xHisExpressionYeastMutationF641G, I645GPromoterpCuAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3400 (YCp LEU2 Rpb1 A1529_G1534delInsLEVLFQGP)
Plasmid#91806PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationResidues A1529-G1534 replaced with a PreScission …PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3477 (YCp LEU2 Rpb1 P1455_E1456InsLEVLFQGP)
Plasmid#91807PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationPreScission Protease site (LEVLFQGP) inserted bet…PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3506 (pET151_Spt6 1247-1451 K1355A,K1435A)
Plasmid#91818PurposeBacterial expression of residues 1247-1451 from S. cerevisiae Spt6 with K1435A and K1355A mutationsDepositorInsertSPT6 (SPT6 Budding Yeast)
Tags6xHisExpressionBacterialMutationchanged lysine 1355 and lysine 1435 to alanines; …PromoterT7Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Donor/Reporter-COL4A3
Plasmid#130279PurposeCOL4A3 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A3 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_COL4A3_self-cleavingCas9
Plasmid#130281PurposeExpresses an spCas9 under the control of a CMV promoter; The spCas9 is flanked by COL4A3 sgRNA targets to induce its self-cleaving and inactivationDepositorInsertspCas9
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_COL4A5_self-cleavingCas9
Plasmid#130282PurposeExpresses an spCas9 under the control of a CMV promoter; The spCas9 is flanked by COL4A5 sgRNA targets to induce its self-cleaving and inactivationDepositorInsertspCas9
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-cpVenus-FLARE-CKAR(T/A)
Plasmid#123344PurposeNegative control mutant for Venus-cpVenus-FLARE-CKAR biosensor.DepositorInsertVenus-cpVenus-FLARE-CKAR(T/A)
Tags6xHIS, T7 tag (gene 10 leader), Venus, Xpress (TM…ExpressionMammalianMutationTarget Thr residue in substrate domain mutated to…PromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-cpCerulean3-FLARE-AKAR
Plasmid#123336PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity. Contains monomeric Cerulean3/cpCerulean3-E173 homoFRET pair.DepositorInsertCerulean3-cpCerulean3-FLARE-AKAR
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), Xpress…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjACTB-EGFP-3'short
Plasmid#129749PurposeGene targeting in marmoset cellsDepositorAvailable SinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjACTB-EGFP-5'short
Plasmid#129748PurposeGene targeting in marmoset cellsDepositorAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only