We narrowed to 15,838 results for: grna
-
Plasmid#136895PurposeLentivirus for base editing activatable GFP expression in mammalian cells. All-in-one vector with sgGO2.DepositorInsertGFPGO-IRES-mScarletI
UseLentiviralTags3xNLS on mScarletExpressionMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-sgHPDL #3
Plasmid#174165Purposeknock out HPDL in human cell linesDepositorInsertsgRNA against HPDL
UseLentiviralTagsExpressionMutationPromoterAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-sgHPDL #9
Plasmid#174166Purposeknock out HPDL in human cell linesDepositorInsertsgRNA against HPDL
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTC217
Plasmid#70018PurposeCas9/sgRNA targeting ANT1 locus, donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a Gemini Viral Replicon based on Bean Yellow Dwarf Virus; sgRNA= 1bDepositorInsertNuclease (Cas9/sgRNA) + Donor + GVR
UseCRISPRTagsExpressionPlantMutationPromoterAvailable SinceMarch 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCtnnd2.1-GFP
Plasmid#209095PurposeGFP expressing shRNA targeting Ctnnd2 N-terminusDepositorInsertshCtnnd2.1
UseTagsExpressionMutationPromoterAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ TREX1-KI
Plasmid#127701PurposeFor knocking in TREX1 in mouse - Doxycyclin inducibleDepositorAvailable SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRDA_118
Plasmid#133459PurposeU6 promoter expresses customizable Spyo-guide; EF1a promoter provides puromycin resistance. This vector is a derivative of the lentiGuide vector, with minor modifications to the tracrRDepositorInsertcontrol guide
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro GFP siRNA
Plasmid#12273DepositorInsertGFP siRNA
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable SinceJuly 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mU6-GFPGO-IRES-mScarletI-PGK-Neo
Plasmid#136897PurposeLentivirus for base editing activatable GFP expression in mammalian cells. All-in-one vector with sgGO.DepositorInsertGFPGO-IRES-mScarletI
UseLentiviralTags3xNLS on mScarletExpressionMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-entry-puro
Plasmid#85745PurposeLentiviral vector for generating multiple sgRNAs carrying plasmids by Golden Gate Assembly.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT10
Plasmid#223382PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTC223
Plasmid#70019PurposeCas9/sgRNA targeting ANT1 locus, donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a Gemini Viral Replicon based on Bean Yellow Dwarf Virus; sgRNA= 7DepositorInsertNuclease (Cas9/sgRNA) + Donor + GVR
UseCRISPRTagsExpressionPlantMutationPromoterAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRa_VPR_yl
Plasmid#107677PurposeCRISPR-dCas9-VPR vector for Yarrowia lipolytica, expressing dCas9-VPR and AvrII site for sgRNA insertionDepositorInsertsCodon optimized dCas9-VPR
sgRNA expression cassette
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterSCR1'-tRNA and UAS1B8-TEF(136)Available SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAf-CRISPR-yA
Plasmid#191015PurposeCRISPR vector based on Aspergillus flavus U6 promoter and terminator for targeting the yA gene, which contains AMA1(the HindIII-PstI fragment) and ptrA selection marker.DepositorInsertyA
UseCRISPRTagsExpressionMutationPromoterAspergillus flavus U6Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC0040-LwaCas13a crRNA backbone
Plasmid#103851PurposeBackbone for cloning guides that are compatible with LwaCas13a. Contains a 5' direct repeat. Clone using BbsI (BpiI). F overhang AAAC. R overhang AAAADepositorInsertU6-LwaCas13aDR-BbsI-BbsI-polyT
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX552-mScn2a-3xV5-EF1-smFP-flag
Plasmid#182561PurposeFor mouse Nav1.2 knockin with 3xV5 at the C-terminalDepositorInsertsmouse Scn2a gRNA and 3xV5 donor DNA
smFP-flag
UseAAV and CRISPRTagsExpressionMutationPromoterEF1 and U6Available SinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
p8092 LentiCRISPR v2 sgNT-1
Plasmid#163315PurposeExpresses Cas9 and a non-targeting control guide RNADepositorInsertsgNT-1
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAS006
Plasmid#211506PurposeAAV genome backbone with a CROP-seq-like design for indirect capture of gRNA sequencesDepositorTypeEmpty backboneUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsExpressionMammalianMutationPromoterAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS088
Plasmid#211502PurposeAAV genome backbone for AAV-Perturb-seq with direct gRNA capture and nuclei sorting based on eGFP.DepositorTypeEmpty backboneUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsExpressionMammalianMutationPromoterAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pICSL01009::AtU6p
Plasmid#46968PurposeEncodes the Arabidopsis U6 promoter in a level 0 vector (Weber et al. PLoS One 6:e16765, 2011). It is used to place an sgRNA uder the Arabidopsis U6 promoter.DepositorInsertAtU6p
UseCRISPRTagsExpressionPlantMutationPromoterAvailable SinceAug. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT11
Plasmid#223383PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT08
Plasmid#223380PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry
Plasmid#78534PurposeBackbone to clone single or paired sgRNAsDepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterU6 (for expressing sgRNA)Available SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-shNTC
Plasmid#217638PurposeDox inducible shRNA non targeting control shRNADepositorInsertshNTC
UseRNAiTagsExpressionMutationPromoterAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-spTRE3G-CMV-mTagBFP2
Plasmid#102854PurposeA plasmid encoding TRE3G sgRNA (for SpCas9) and mTagBFPDepositorInsertsp-TRE3G-sgRNA; mTagBFP2
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promoterAvailable SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mU6-Luc2GO-PGK-Neo
Plasmid#136905PurposeLentivirus for base editing activatable Luciferase2 expression in mammalian cells. All in one vector with sgLuc2GO.DepositorInsertLuc2CyGo
UseLentiviralTagsExpressionMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pLVUHshp53
Plasmid#11653DepositorInsertGFP, shRNA against TP53 (TP53 Human)
UseCre/Lox, Lentiviral, and RNAiTagsExpressionMammalianMutationPromoterAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pIW601-KmCRISPR
Plasmid#98907PurposeK. marxianus CRISPR Plasmid for sgRNA cloningDepositorInsertsCodon optimized Cas9
sgRNA expression cassette
UseCRISPR and Synthetic BiologyTagsSV40ExpressionYeastMutationPromoterAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only