We narrowed to 8,732 results for: sgRNA
-
Plasmid#222135PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pEIF3D-CtermDel-sgEIF3D
Plasmid#222125PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-a5helixDel-sgEIF3D
Plasmid#222133PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-S528N-S529N-sgEIF3D
Plasmid#222129PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Sha3Cas9
Plasmid#192136PurposeExpresses Sha3Cas9, and cloning backbone for sgRNADepositorInsertSha3Cas9
UseAAVExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med6_C_terminal
Plasmid#197869PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCsDepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-Y-P2A-puro
Plasmid#192132PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-Y
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-dora[B]_rescue_construct
Plasmid#190638PurposePuromycin-selectable expression of HA-tagged Dora[T295M] (CG34401) in Drosophila S2 cellsDepositorInsertDorado (CG34401 Fly)
Tags3xHAExpressionInsectMutationChanged threonine 295 to methioninePromoterActin-5cAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-dora[A]_rescue_construct
Plasmid#190640PurposePuromycin-selectable expression of HA-tagged truncated Dora (CG34401) in Drosophila S2 cellsDepositorInsertDorado (CG34401 Fly)
Tags3xHAExpressionInsectMutationTruncated to contain amino acids 1-945PromoterActin-5cAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-scrambled
Plasmid#183455PurposeThis control vector contains a scrambled version of the targeting sequence used in the pFUGW-shRIIα constructDepositorInsertscrambled sgRNA
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-CfANLN
Plasmid#183837PurposeRepair template for the N-terminal tagging of anillin with mNeonGreen in canine cells using CRISPR/Cas9.DepositorInsertCanis familiaris ANLN homology arms with mNeonGreen-linker
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_CV2
Plasmid#167165PurposepgRNA_CV2 is derived from gRNA_cloning vector (Addgene plasmid ID: 41824) by adding about 80 bps from the sgRNA sequence as well as an AgeI site. In the literature, sgRNA_AL is used as an alias.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 CARD8 PAM
Plasmid#169975PurposepDONR221 for Gateway shuttling. Contains CARD8 (no stop codon) with sgRNA binding site mutationsDepositorAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRWJB006
Plasmid#160113PurposeDestination vector expressing plant-codon-optimized Cas9 under 35S promoter (BamHI and NotI), with sgRNAs be shuffled in; seed coat specific red fluorescence for screening trangene freeDepositorTypeEmpty backboneUseCRISPRExpressionBacterial and PlantPromoter35SAvailable SinceFeb. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
MTK234_038
Plasmid#123917PurposeEncodes the spCas9 pSV40 (site 1) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA-pSV40
ExpressionMammalianAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK234_043
Plasmid#123913PurposeEncodes the spCas9 pSV40 (site 2) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA-pSV40
ExpressionMammalianAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Bth
Plasmid#129686Purpose(Empty backbone) Gateway entry clone with sgRNA under ZmUbi promoterDepositorInsertEmpty Backbone
UseCRISPRExpressionPlantAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Bh
Plasmid#136378PurposeGateway entry clone for BhCas12b sgRNA expression under ZmUbi promoter with ribozyme processingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only