We narrowed to 9,707 results for: crispr plasmids
-
Plasmid#214019Purposeinducible PE2 system for controllable prime editing; this plasmid is used to insert PE2 prime editor in one allele of AAVS1 locusDepositorInsertPE2
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-HLP-SACas9-HA-OLLAS-spA
Plasmid#206860PurposeAn AAV plasmid with U6 promoter driving a gRNA against LDLR and liver specific HLP promoter driving SaCas9DepositorInsertmLdlr gRNA (Ldlr Mouse)
UseAAV and CRISPRAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gL1HSg1dCas9-KRAB-T2a-GFP
Plasmid#234882PurposeL1HS-silencing plasmid (CRISPRi gRNA1)DepositorInsertL1HS-silencing plasmid (CRISPRi gRNA1)
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ABE-NT-sgRNA
Plasmid#112734PurposeAAV inverted terminal repeat based vector plasmid encoding E. coli TadA, the N-terminal half of nCas9 and sgRNADepositorInsertABE-NT-sgRNA
UseAAVAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pL90-Nat-2xHO
Plasmid#139069PurposeCRISPR/Cas9 engineering of the HO endonuclease gene with nourseothricin selectionDepositorInsertTwo guide RNAs targeting the HO endonuclease
ExpressionBacterial and YeastPromoterTDH3Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
IF311: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-LSD1
Plasmid#121824PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the LSD1 H3K4me1/2 demethylase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/LSD1 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gLacZ.hSyn.H2B.RFP
Plasmid#170369PurposeNegative control plasmid used for Crispr/cas9 based disruption. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
KL301: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS-p300core
Plasmid#121839PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS/p300core scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LPUtopia-7_CoV-2
Plasmid#224782PurposeLanding Pad donor vector containing partial RdRp and N gene sequences from SARS-CoV-2 for fluorescent reporter assayDepositorAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTOR-F2108L_DARIC(1)_CD19-scFv_AAV6_Donor
Plasmid#211905PurposeVector for AAV6 donor production. Targeted CD19-scFv DARIC transgene integration to the MTOR locus with the dominant rapamycin resistance MTOR-F2108L mutation via homology-directed repair.DepositorInsertDARIC-CD19-scFv
UseAAVExpressionMammalianPromoterhPGK1Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
hsLEMD2-pX330
Plasmid#179511PurposeEncodes gRNA for human LEMD2DepositorInsertgRNA for LEMD2
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cas9_nonPuro_OSS
Plasmid#186652PurposeCas9 plasmid to express the Cas9 in OSS cellsDepositorInsertOSS Cas9 Expression Plasmid
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
IF405: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-p300core
Plasmid#121825PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the p300 catalytic core for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/p300core (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KL001: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS-VPR
Plasmid#121836PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS/VPR scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KL202: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS-LSD1
Plasmid#121838PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS/LSD1 scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IA304: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-VPR
Plasmid#121822PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the VPR transcriptional activator for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/VPR (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ring2-FLAG-AID-mClover
Plasmid#246226PurposeExpression of Ring2-FLAG-AIDDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hGSDMD
Plasmid#185377PurposeFor mammalian expression of guide RNA: CGCGCCAGACGCGCCACCCT that targets human GSDMD (Gasdermin D)DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_mouse_Adar1_ccB
Plasmid#158122Purposedeletion mAdar1DepositorInsertAdar1 (Adar Mouse)
ExpressionMammalianAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only