We narrowed to 893 results for: V2
-
Plasmid#201601PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L (LUC7L Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-LUC7L2_sgRNA2
Plasmid#201603PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L2 (LUC7L2 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PABPC1_sgRNA2
Plasmid#201609PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPABPC1 (PABPC1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGMC00007
Plasmid#166725Purposenon targeting sgRNADepositorInsertNon-targeting guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-XYLT2-sgRNA
Plasmid#154862PurposeLentiviral expression of Cas9 and sgRNA targeting XYLT2DepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
lenti MS2-P65-HSF1_Hygro
Plasmid#61426Purposelenti vector encoding the MS2-P65-HSF1 activator helper complex with a 2A Hygro resistance marker NOTE: A version of this plasmid with improved titer is available: Addgene plasmid #89308 lentiMPH v2DepositorInsertMS2-P65-HSF1_2A_Hygro (HSF1 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianMutationN55K in MS2PromoterEF1AAvailable SinceDec. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP FL
Plasmid#179550Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human CBP driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human CBP (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
aav-tnt-wtmrtfa-gfp
Plasmid#165037PurposeAAV-based delivery of wtMRTFA-GFP into cardiomyocytes in vivoDepositorAvailable SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOT_2 - lenti-EFS-tNGFR-2A-puro
Plasmid#181971PurposeExpresses human truncated NGFR linked to puromycin resistance via P2A for lentiviral delivery.DepositorAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/NDUFV2/myc-His
Plasmid#127491PurposeExpresses myc-tagged NDUFV2 in mammalian cellsDepositorAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOT_1 - lenti-EFS-LTBR-2A-puro
Plasmid#181970PurposeExpresses human LTBR linked to puromycin resistance via P2A for lentiviral delivery.DepositorInsertLTBR (LTBR Human)
UseLentiviralAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgAMPKa1
Plasmid#138704PurposeExpresses a human AMPKa1-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgAMPKa2
Plasmid#138685PurposeExpresses a human AMPKa2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hCRY1 c-term
Plasmid#179453PurposeLentiviral Crispr/Cas9 plasmid targeting hCRY1 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human CRY1
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti U6-sgRNA-acRNA SYN-dCas9-P2A-EGFP
Plasmid#159086PurposeExpresses dCas9-P2A-EGFP driven by human SYN promoter and empty CRISPR Display sgRNA/accessory RNA from U6 promoter.DepositorInsertempty crRNA-acRNA backbone, dCas9-P2A-EGFP
UseCRISPR and LentiviralTagsEGFP and FLAGExpressionMammalianPromoterhSYN, U6Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-GCN5 FL
Plasmid#179552Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human GCN5 driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human GCN5 (KAT2A Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA1
Plasmid#201590PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc
Plasmid#208382PurposeDerived from LentiCRISPRV2 by replacing Cas9 with Cre recombinase and puromycin resistance with GpNLuc. Contains a stuffer sequence for cloning of sgRNA of interest, as per LentiCRISPRV2.DepositorTypeEmpty backboneUseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgAMPKa1
Plasmid#138684PurposeExpresses a human AMPKa1-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only