We narrowed to 8,419 results for: BLI
-
Plasmid#64877Purposelentiviral expression of human POLQ K121M mutant (a mutation in the conserved ATP-binding site of the Walker A motif in the helicase-like domain)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationK121M, a mutation in the conserved ATP-binding si…PromoterEF1alphaAvailable sinceOct. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-DY2230AA
Plasmid#64878Purposelentiviral expression of human POLQ -DY2230AA mutant (a polymerase domain mutant)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationD2330A,Y2331A, in the DNA polymerase domain (POL)…PromoterEF1alphaAvailable sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
attB53-Pac-TRE-3xFlag-Neurog1-attB53
Plasmid#183613PurposeRMCE vector to shuttle puromycin resistance and TRE-3xFlag-Neurog1 cassettes into attP50-flanked landing pad. Designed for use with pmROSA26-attP50-Neo-mKate2-3xNLS-attP50 vector (Addgene 183609).DepositorInsertNeurog1 (Neurog1 Mouse)
UseRmceTags3xFlagExpressionMammalianMutationPromoterTREAvailable sinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
SARS-COV2-NSP1-HA-BASU
Plasmid#154071PurposeExpress SARS-CoV-2 NSP1 gene along with HA and BASUDepositorInsertNsp1 (ORF1ab Severe acute respiratory syndrome coronavirus 2)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-mEmerald Rab7a
Plasmid#115238PurposeTo express in mammalian cells the endocytic protein Rab7a fused to mEmerald by transfection or by generating AAV virions.DepositorInsertRab7a fused to mEmerald (RAB7A Human)
UseAAVTagsmEmeraldExpressionMammalianMutation7 Amino Acids (21 Nucleotides) between mEmerald a…PromoterHuman UbCAvailable sinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
iSH-iRFP670-sspB
Plasmid#176102PurposeHeterodimerization with iLID, phosphatidylinositol 3-kinase derived iSHDepositorInsertphosphatidylinositol 3-kinase (Pik3r1 Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 KanR foundation lox casette
Plasmid#132388PurposeFoundation cassette containing lox sites for cre-mediated exchange of inducible vectors, confers mammalian G418 resistance, targets AAVS1 locusDepositorInsertG418 resistance
UseCRISPR and Cre/LoxTagsExpressionMammalianMutationPromoterpromoterlessAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS423-mitoT
Plasmid#174525PurposeExpresses yeast variant of mitoT synthetic intermembrane tether bridging the inner and outer mitochondrial membranesDepositorInsertYeast mitochondrial intermembrane tether
UseSynthetic BiologyTagseGFPExpressionYeastMutationPromoterMET25Available sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked Free PcPTS
Plasmid#182486PurposeYeast integrative plasmid for expressing fusion protein ERG20-PcPTS, with linker sequence AG4TGGA (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertFPPS-PTS
UseSynthetic Biology; Metabolic engineeringTagsExpressionYeastMutationPromoterGAL10Available sinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA BfuAI stuffer A-tract
Plasmid#138525PurposeExpresses a guide RNA of choice cloned into the BfuI site extended at the 3' end to incorporate a 220-nt control A-tract repeat RNA sequence.DepositorInsertControl non-PRC2 binding A-tract repeat RNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRCreb5gRNA
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorInsertCreb5 gRNA (CREB5 Bovine)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA BfuAI stuffer G-tract
Plasmid#138524PurposeExpresses a guide RNA of choice cloned into the BfuI site extended at the 3' end to incorporate a 220-nt PRC2-binding G-tract repeat RNA sequence.DepositorInsertPRC2-binding G-tract repeat RNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 VAMP2 R125TAG
Plasmid#69876Purposeexpress in mammalian cells for unnatural amino acid incorporation into VAMP2-GFPDepositorInsertVAMP2-GFP (Vamp2 Rat)
UseSynthetic BiologyTagsGFPExpressionMammalianMutationAmber stop codon in the linker between VAMP2 and …PromoterAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET21-10XHis-GST-HRV-Her2-dL5-Her2
Plasmid#85624PurposeBacterial expression vector for Z342-dL5(E52D)-Z342 affibody fusion protein (AFA) with N-terminal His10, GST and HRV3C cleavage site (MBIC5, dL5**, FAP, AffiFAP)DepositorInsert10XHis-GST-HRV-Her2-dL5-Her2 (EGFR Synthetic, Schistosoma japonicum, Human)
UseTags10XHis-GST-HRV and The Her2 Affibody and dL5 FAP …ExpressionBacterialMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterT7Available sinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hGLIS1GR
Plasmid#59312PurposeForced expression of human GLIS1GRDepositorInsertGLIS1 (GLIS1 Human)
UseRetroviralTagscGR - hormone binding domain of glucocorticoid re…ExpressionMammalianMutationPromoterAvailable sinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pN1 VAMP2 R125TAG
Plasmid#69877Purposeexpress in mammalian cells for unnatural amino acid incorporation into VAMP2DepositorInsertVAMP2 (Vamp2 Rat)
UseSynthetic BiologyTagsExpressionMammalianMutationAmber and Ochre stop codons in the former linker …PromoterAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFP
Plasmid#166676PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertsVP2C-GFP
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyTagsExpressionYeastMutationPromoterGAL1 and GAL10Available sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
-