We narrowed to 5,952 results for: crispr cas9 expression plasmids
-
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS415-Cas9-VPR
Plasmid#163971PurposeTrifunctional Cas9-VPR fusion protein plasmid for simultaneous transcriptional activation, transcriptional repression, and genome editing in yeastDepositorInsertCas9-VPR
UseSynthetic BiologyExpressionYeastAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.GFP
Plasmid#57818PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGPromoterEFS and hU6Available SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.tRFP
Plasmid#57819PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1876-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223162PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1861-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223161PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCB-CRISPRi
Plasmid#221136PurposeCoxiella burnetii CRISPRi plasmid without sgRNA construct. Expresses 3xF-dCas9.DepositorInsert3xF-dCas9
UseCRISPRTags3xFLAGExpressionBacterialPromotercbu1169 promoterAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-nSpCas9(H840A)-BPNLS(SV40)-3xFLAG-P2A-EGFP (HES140)
Plasmid#185490PurposeCMV and T7 promoter expression plasmid for human codon usage nSpCas9(H840A) with a C-terminal bi-partite NLS, 3x FLAG, and P2A-eGFPDepositorInserthuman codon usage nSpCas9(H840A)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-eGFPExpressionMammalianMutationH840APromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-nSpCas9(D10A)-BPNLS(SV40)-3xFLAG-P2A-EGFP (HES24)
Plasmid#185492PurposeCMV and T7 promoter expression plasmid for human codon usage nSpCas9(D10A) with a C-terminal bi-partite NLS, 3x FLAG, and P2A-eGFPDepositorInserthuman codon usage nSpCas9(D10A)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-eGFPExpressionMammalianMutationD10APromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-10xSunTag-P2A-tagBFP
Plasmid#174141PurposeExpresses the dCas9-10xSunTag-tagBFP fusion protein for the recruitment of scFv(GCN4)-fused effector domains. A shorter version of the Addgene 60903 plasmid.DepositorInsertdCas9, 10xSunTag, tagBFP
TagsHA and tagBFPExpressionMammalianPromoterSV40Available SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-1
Plasmid#237890PurposeCre-KO AAV vector#1 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-2
Plasmid#237891PurposeCre-KO AAV vector#2 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-3
Plasmid#237892PurposeCre-KO AAV vector#3 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
KN901: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-KRAB
Plasmid#121830PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/KRAB (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLIII CKBs CRISPR with guides at 1-2 and 2-3
Plasmid#238525PurposePlant expression of Cas9 and gRNAs against A. thaliana CK2alpha3DepositorAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiV2-EF1α-nCas9/RT
Plasmid#210188PurposeExpression of nCas9/RT-P2A-PuroDepositorInsertnCas9/RT-P2A-Puro
UseLentiviralAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
LF701: pMAGIC (L1-R5) hU6::xCas9(3.7) gRNA scaffold
Plasmid#121817PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LG002: pMAGIC (L1-R5) mU6::xCas9(3.7) gRNA scaffold
Plasmid#121816PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JI601: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; RIP
Plasmid#121815PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and RIP for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JI702: pMAGIC (L5-L4) hU6::SaCas9 gRNA scaffold; RIP
Plasmid#121820PurposepMAGIC L5-L4 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and RIP for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
(517) SB KRAB-SadCas9 U6-gStop
Plasmid#163023PurposeSleeping Beauty TET-On expression of CRISPRi with gSTOP gRNADepositorInsertMammalian codon-optimized SadCas9
UseTransposonTagsKRAB and myc NLSExpressionMammalianPromoterTet-OnAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_NFATC2-sgRNA
Plasmid#188704PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and 4 sgRNAs targeting human NFATC2DepositorInsertNFATC2 sgRNAs
UseLentiviralExpressionMammalianPromoterhUbCAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_COL4A3_self-cleavingCas9
Plasmid#130281PurposeExpresses an spCas9 under the control of a CMV promoter; The spCas9 is flanked by COL4A3 sgRNA targets to induce its self-cleaving and inactivationDepositorInsertspCas9
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_COL4A5_self-cleavingCas9
Plasmid#130282PurposeExpresses an spCas9 under the control of a CMV promoter; The spCas9 is flanked by COL4A5 sgRNA targets to induce its self-cleaving and inactivationDepositorInsertspCas9
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2047-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223167Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only