We narrowed to 10,928 results for: cat.1
-
Plasmid#129258PurposeExpress QuaAr3_Q95D_H106N_E214V-HaloTag in mammalian cellsDepositorInsertQuaAr3_Q95D_H106N_E214V-HaloTag
ExpressionMammalianMutationQ95D, H106N, E214VPromoterCAGAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
dCas9-dMSK1
Plasmid#165602PurposeExpresses Sp dCas9 fused to truncated human MSK1 (42-802)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated human Mitogen- and stress-activated protein kinase-1 (42-802) (RPS6KA5 S. Pyogenes, Human, Synthetic)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianPromoterEF1aAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEasiLV-MCS-coICP0fxe
Plasmid#235546PurposeTo express ICP0-FXE (ICP0 ∆106-149, doxycycline inducible)DepositorInsertICP0
UseLentiviralMutationDeletion of the RING domain, ∆106-149.Available SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3b(1454/3172)P2P-wt
Plasmid#21404DepositorAvailable SinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pL0_AC-27877
Plasmid#202110PurposeLevel 0 plasmid containing the promoter from gene 27877 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert27877 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_CE-OriT
Plasmid#202150PurposeLevel 0 plasmid containing an origin of transfer sequence from pPtPBR11 required for making plasmids mobilizable for conjugation with CE overhangs used to build level 1 constructs.DepositorInsertOrigin of transfer
UseSynthetic BiologyMutationOriT sequence mutated to remove sapI sites domest…Available SinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-Fld
Plasmid#202125PurposeLevel 0 plasmid containing the promoter from gene 23658 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertFld promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-54730
Plasmid#202109PurposeLevel 0 plasmid containing the promoter from gene 54730 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert54730 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-51183
Plasmid#202108PurposeLevel 0 plasmid containing the promoter from gene 51183 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert51183 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-GEF
Plasmid#202107PurposeLevel 0 plasmid containing the promoter from gene 41365 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertGEF promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-47740
Plasmid#202106PurposeLevel 0 plasmid containing the promoter from gene 47740 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert47740 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-BCA
Plasmid#202105PurposeLevel 0 plasmid containing the promoter from gene 51305 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertBCA promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-epyC
Plasmid#202104PurposeLevel 0 plasmid containing the promoter from gene 41316 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertepyC promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
His-Thrombin-Munc13-1 C1-C2B-MUN-C2C R1598E F1658E (delta1408-1452 delta1533-1551)
Plasmid#243822PurposeMunc13-1 protein purificationDepositorInsertMunc13-1 (Unc13a Rat)
TagsHisExpressionBacterialMutationdelta1408-1452 delta1533-1551 R1598E F1658EAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK Blast DEST ERKKTRmRuby2
Plasmid#90231PurposeLentiviral vector to express ERK KTR mRuby2 under PGK promoter (With Blasticidin Resistance)DepositorInsertERK Kinase Translocation Reporter
UseLentiviralTagsmRuby2ExpressionMammalianPromoterPGKAvailable SinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
dCas9-ddMSK1
Plasmid#165603PurposeExpresses Sp dCas9 fused to truncated inactive human MSK1 (42-802, D195A, D565A)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated inactive human Mitogen- and stress-activated protein kinase-1 (42-802, D195A, D565A) (RPS6KA5 S. Pyogenes, Human, Synthetic)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianPromoterEF1aAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
hCXCR4-mTQ2
Plasmid#110196PurposeEncodes for human CXCR4 coding sequence tagged with the mTQ2 FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
hCXCR4-LSSmOrange
Plasmid#110197PurposeEncodes for human CXCR4 coding sequence tagged with the LSS-mOrange FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3b(1454/3172)P2P-mut
Plasmid#21405DepositorInsertEGLN1 (EGLN1 Human)
UseLuciferaseExpressionMammalianMutationhypoxia response element mutatedAvailable SinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pPN432
Plasmid#137870PurposeExpression of gRNA a3 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN435
Plasmid#137867PurposeExpression of gRNA i3 targeting TCF4 for CRISPRi; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN446
Plasmid#137868PurposeExpression of gRNA a1 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN454
Plasmid#137865PurposeExpression of gRNA i1 targeting TCF4 for CRISPRi; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV1_Rep52-VP1
Plasmid#232174PurposeExpression of replication/capsid proteins for AAV serotype 1DepositorInsertRep52, VP1 of AAV-1
UseAAVExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPLV_C1
Plasmid#186415PurposeEndogenous murine RNase inhibitor production for cell-free lysateDepositorInsertMurine RNase Inhibitor
UseSynthetic BiologyPromoterT7Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Green cGull
Plasmid#86867PurposeGreen fluorescent probe for cGMPDepositorInsertGreen cGull
ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Huc-Positron-ST
Plasmid#129265Purposepan neuronal expression of soma-localized Positron in zebrafishDepositorInsertPositron-ST
UseZebrafish expressionMutationD92N, E199VAvailable SinceAug. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-LRF
Plasmid#66936PurposeDestination vector; gateway cassette cloned upstream of basal promoter driving luciferase. Forward orientation (attR1, attR2).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterSV-40Available SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT2-Tbait-UAS-Positron-ST
Plasmid#129266PurposeUAS-driven expression of Positron in zebrafishDepositorInsertPositron-ST
UseZebrafish expressionMutationD92N, E199VAvailable SinceAug. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Ace2_D92N_E199V-mNeon-ST
Plasmid#129261PurposeExpress soma-localized Ace2_D92N_E199V-mNeon in mammalian cellsDepositorInsertAce2_D92N_E199V-mNeon-ST
ExpressionMammalianMutationD92N, E199VPromoterCAGAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Ace2_D92N_E199V-mRuby3-ST
Plasmid#129262PurposeExpress soma-localized Ace2_D92N_E199V-mRuby3 in mammalian cellsDepositorInsertAce2_D92N_E199V-mRuby3-ST
ExpressionMammalianMutationD92N, E199VPromoterCAGAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-LRR
Plasmid#66937PurposeDestination vector; gateway cassette cloned upstream of basal promoter driving luciferase. Reverse orientation (attR2, attR1).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterSV-40Available SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-YOD1 C160S
Plasmid#49785PurposeExpress YOD1 C160S mutant with a N-terminal Flag-tag in mammalian cellsDepositorAvailable SinceDec. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
S7_SwaI_Zeo_PacI
Plasmid#128471PurposeZeo Resistance geneDepositorInsertZeocin Resistance gene
ExpressionBacterialAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCX:γB2ΔICD-EC5-VenusΔN3C9-P3
Plasmid#209090PurposemVenus-inserted PcdhgB2 lacking an intracellular domain (ICD)DepositorAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Mac_Q139D_D150N_E258V-HaloTag-ST
Plasmid#129264PurposeExpress soma-localized Mac_Q139D_D150N_E258V-HaloTag in mammalian cellsDepositorInsertMac_Q139D_D150N_E258V-HaloTag-ST
ExpressionMammalianMutationQ139D,D150N,E258VPromoterCAGAvailable SinceAug. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-QuaAr3_Q95D_H106N_E214V-HaloTag-ST
Plasmid#129263PurposeExpress soma-localized QuaAr3_Q95D_H106N_E214V-HaloTag in mammalian cellsDepositorInsertQuaAr3_Q95D_H106N_E214V-HaloTag-ST
ExpressionMammalianMutationQ95D, H106N, E214VPromoterCAGAvailable SinceAug. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Ace1_Q89D_D100N_E206V-HaloTag-ST
Plasmid#129260PurposeExpress soma-localized Ace1_Q89D_D100N_E206V-HaloTag in mammalian cellsDepositorInsertAce1_Q89D_D100N_E206V-HaloTag-ST
ExpressionMammalianMutationQ89D, D100N, E206VPromoterCAGAvailable SinceAug. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKSJ375
Plasmid#103064PurposeExpresses ImmE1, immunity to colicin E1DepositorExpressionBacterialPromoterE1 immunity protein promoter from ColE1Available SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only