We narrowed to 13,356 results for: ache
-
Plasmid#105795PurposeExpression of your protein of interest in fusion with green fluorescent protein at the C-terminus (cleavable by TEV). mClover3 is a brighter derivative of mEGFP (PMID: 26879144).DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mClover3ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pCMV_eA3A T31A-NG-nCas9
Plasmid#163539PurposeMammalian CG-to-GC base editingDepositorInserteA3A T31A-NG-nCas9
UseCRISPRExpressionMammalianMutationnCas9 (D10A)eA3A T31ANG (L111R, D1135V, G1218R, E…Available SinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 6B codon-optimized NLRP1 CARD-mCherry WT
Plasmid#163991PurposeMammalian expression vector encoding codon-optimized human NLRP1 CARD with a C-terminal mCherry tag for imagingDepositorAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pNOC_hlbCas12a-Nlux
Plasmid#176240PurposepNOC episomal plasmid harboring the humanized lbCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized lbCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-ProtC-HA
Plasmid#162103PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-ProtC-HA
UseLentiviralTagsVSVg-ProtC-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-HA-FLAG
Plasmid#162106PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-HA-FLAG
UseLentiviralTagsVSVg-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-ProtC-AU1
Plasmid#162111PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to StrepTagII-ProtC-AU1
UseLentiviralTagsStrepTagII-ProtC-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-ProtC-HA-AU1
Plasmid#162116PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to ProtC-HA-AU1
UseLentiviralTagsProtC-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-HA-AU1
Plasmid#162087PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-HA-AU1
UseLentiviralTagsVSVg-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-ProtC-FLAG
Plasmid#162090PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-ProtC-FLAG
UseLentiviralTagsStrepTagII-ProtC-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-ProtC-HA-FLAG
Plasmid#162095PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to ProtC-HA-FLAG
UseLentiviralTagsProtC-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-ProtC-FLAG-AU1
Plasmid#162097PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to ProtC-FLAG-AU1
UseLentiviralTagsProtC-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-StrepTagII-AU1
Plasmid#162082PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-StrepTagII-AU1
UseLentiviralTagsVSVg-StrepTagII-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-ProtC-HA
Plasmid#162109PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to StrepTagII-ProtC-HA
UseLentiviralTagsStrepTagII-ProtC-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc LbaCas12a
Plasmid#182125PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc LbaCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc LbaCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A mKate2-hu_ncOGT WT
Plasmid#154282PurposeEntry vector encoding mKate2-2xFLAG-OGT (O-GlcNAc Transferase; WT)DepositorInsertO-GlcNAc Transferase (OGT Human)
UseGateway entry vectorTags2x FLAG and mKate2MutationWT OGTAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-IgM-IRES-GFP
Plasmid#187011PurposeExpression of human anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgMDepositorInsertHuman anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgM
UseLentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only