We narrowed to 8,909 results for: sgRNA
-
-
pGL3-U6-pegRNA_FANCF-EGFP
Plasmid#159785PurposeS. pyogenes pegRNA for C to A mutation at the FANCF site of human cells using prime editingDepositorInsertspacer of pegRNA targeting FANCF gene (FANCF Human)
ExpressionMammalianAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgFah.CMV/CB-EGFP
Plasmid#121508PurposeExpresses sgRNA targeting mouse Fah intron 7 (sgFah).DepositorInsertsgFah
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPN186
Plasmid#91573PurposeExpress sgRNA targeting human AKT3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJMP1344
Plasmid#119273Purposeknockdown folA in E. aerogenesDepositorInsertsgRNA folA (E. aerogenes)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1106
Plasmid#119249Purposeconstruction intermediateDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα-RIIαWT-IRES-EGFP
Plasmid#183456PurposeReplacement of endogenous rat PKA-RIIα subunits with wild-type RIIαDepositorInsertsgRNA and Prkar2a (Prkar2a Rat)
UseLentiviralMutationshRNA-resistant mutations: C135>G, G138>A, …PromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-SLC35B2-FLAG
Plasmid#154863PurposeTransient or Lentiviral expression of sgRNA (Addgene#154860) resistant SLC35B2DepositorInsertSLC35B2 (SLC35B2 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationctcctggtgcagtacttc => ttattagtccaatattttPromoterCMVAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN187
Plasmid#91574PurposeExpress sgRNA targeting human AKT3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
API5-CRISPR
Plasmid#157664PurposeExpresses Cas9 and sgRNA targeting API5DepositorAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 tTA SDHA
Plasmid#177976PurposeAll-in-one dox-repressible expression of cDNADepositorInsertSDHA (SDHA Human)
UseLentiviralExpressionMammalianMutationSilent point mutations to SDHA sgRNA targetAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha1 clone3
Plasmid#162121PurposeLentiviral sgRNA plasmid targeting human AMPK alpha1DepositorInsertsgAMPK alpha1 (PRKAA1 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
ARB365
Plasmid#124048PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to mRuby2 P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::mRuby2-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-H1-sgGFP1-7SK-sgCas9
Plasmid#87908Purposemultiple sgRNADepositorInsertsgGFP1, sgCas9
UseGateway entry vectorPromoterH1, 7SKAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAWp28-v1 scaffold
Plasmid#157976PurposepBT264-U6p-{2xBbsI}-v1 sgRNA scaffold-{MfeI} Note: This plasmid is unstable. Screen multiple colonies to identify full length clones.DepositorTypeEmpty backboneAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAWp102-v2 scaffold
Plasmid#157978PurposepBT264-mutmU6p-{2xBbsI}-v2 sgRNA scaffold-{MfeI}DepositorTypeEmpty backboneAvailable SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgGTTG.CMV/CB-Gluc
Plasmid#121512PurposeExpresses sgRNA targeting the intron in the MADM alleles (GT and TG).DepositorInsertsgGTTG
UseAAVExpressionMammalianPromoterU6Available SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-pegRNA_HOXD13_CtoT-EGFP
Plasmid#159792PurposeS. pyogenes pegRNA for C to T mutation at the HOXD13 site of mouse cells using prime editingDepositorInsertspacer of pegRNA_HOXD13_CtoT targeting HOXD13 gene (HOXD13 Human)
ExpressionMammalianAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only