We narrowed to 9,600 results for: CAG
-
Plasmid#168242Purpose"Rescue Rac expression in neutrophil specific knockout"DepositorInsertRac(guide resistant)-WT
UseZebrafish expressionTagsmcherryPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgULK1-1
Plasmid#109004PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1A gRNA (BRDN0001147420)
Plasmid#77964Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PTK6 gRNA (BRDN0001149364)
Plasmid#76490Purpose3rd generation lentiviral gRNA plasmid targeting human PTK6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-Puro HLAG-2B-sgRNA
Plasmid#182552PurposeCas9 from S.pyogenes with 2A-Puro, and the 2B-sgRNA to targeting exon 2 of human HLA-G geneDepositorInserthSpCas9-2A-Puro-HLAG-2B-sgRNA
UseCRISPRExpressionMammalianPromoterCbhAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pegAAT K342E correction
Plasmid#169841PurposeExpress a pegRNA used for correction (via A•T-to-G•C) of the E342K mutationDepositorInsertpegAAT K342E correction (SERPINA1 Human)
ExpressionMammalianAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mNeurog2 gRNA_1-MS2-Puro
Plasmid#192680PurposeLentiviral expression of sgRNA targeting mIL1RN promoter to activate mouse Neurog2 transcriptionDepositorInsertMouse Neurog2 activating gRNA #1 (Neurog2 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV_mU6-sgNGN3_hU6-sgRNA_hUbC-PuroR-P2A-GFP
Plasmid#162336PurposeLentiviral expression of sgNGN3 paired with a second S. pyogenes sgRNA with a GFP-P2A-PuroR selection markerDepositorInsertS. pyogenes sgRNA
UseLentiviralExpressionMammalianPromoterhU6; mU6Available SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145885)
Plasmid#80196Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPN098
Plasmid#91625PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN099
Plasmid#91626PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1B gRNA (BRDN0001146307)
Plasmid#77085Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1B gRNA (BRDN0001148929)
Plasmid#77086Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRPS2 gRNA (BRDN0001147559)
Plasmid#78005Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRPS2 gRNA (BRDN0001487102)
Plasmid#78006Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hPDX1_promoter_guide1
Plasmid#176838PurposeTo induce human PDX1 expression by recruiting SAM complex to PDX1 promoterDepositorInsertsgPDX1
ExpressionMammalianPromoterU6Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ADCK3 gRNA (BRDN0001146491)
Plasmid#77323Purpose3rd generation lentiviral gRNA plasmid targeting human ADCK3DepositorInsertADCK3
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXM1_iso1_1
Plasmid#135752PurposeEncodes gRNA for 3' target of human FOXM1_iso1DepositorAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only