We narrowed to 255 results for: px459
-
Plasmid#178801PurposeHigh-fidelity SpCas9-HF1 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pX459_V2.0_pSpCas9(BB)-2A-Puro_T-REX17_Ex1_KI
Plasmid#195504PurposeCas9-2A-Puro expression vector bearing a sgRNA targeting Exon 1 of human lncRNA T-REX17DepositorInsertsgRNA
UseCRISPRTags3XFLAG, Puro, and T2AExpressionMammalianMutationPromoterU6Available sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 exon
Plasmid#176033PurposeA vector for the CRISPR-Cas9 system targeting an exon of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 intron
Plasmid#176224PurposeA vector for the CRISPR-Cas9 system targeting an intron of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Daxx KO sgRNA
Plasmid#186939PurposeDaxx KO in mouse ES cellsDepositorInsertDaxx KO sgRNA (Daxx Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6Available sinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Pole4 KO sgRNA
Plasmid#186935PurposePole4 KO in mouse ES cellsDepositorInsertPole4 KO sgRNA (Pole4 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6Available sinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Pole3 KO sgRNA
Plasmid#186934PurposePole3 KO in mouse ES cellsDepositorInsertPole3 KO sgRNA (Pole3 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6Available sinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorInsertCASP8 (CASP8 Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hARAF-1
Plasmid#185367PurposeFor mammalian expression of guide RNA: caccgTGGTCTACCGACTCATCAAG that targets human ARAFDepositorInsertARAF (ARAF Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hBRAF-1
Plasmid#185365PurposeFor mammalian expression of guide RNA: caccgACAACAGTTATTGGAATCTC that targets human BRAFDepositorInsertBRAF (BRAF Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hBRAF-2
Plasmid#185366PurposeFor mammalian expression of guide RNA: caccgAAAATCCCACAGATGTGGCA that targets human BRAFDepositorInsertBRAF (BRAF Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-H2BC11_sgRNA
Plasmid#183883PurposepX459V2.0-HypaCas9 plasmid with H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorInsertH2BC11 sgRNA spacer (H2BC11 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-MYH10_sgRNA
Plasmid#183887PurposepX459V2.0-HypaCas9 plasmid with MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.DepositorInsertMYH10 sgRNA spacer (MYH10 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-CfANLN_sgRNA
Plasmid#183880PurposepX459V2.0-HypaCas9 plasmid with cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterU6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-exon1
Plasmid#177261PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-5’UTR
Plasmid#177260PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459) V2.0
Plasmid#62988PurposeCas9 from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0)DepositorHas ServiceCloning Grade DNAInserthSpCas9-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCbhAvailable sinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-AAVS1_sgRNA
Plasmid#183890PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and sgRNA targeting the AAVS1 in human cells.DepositorInsertAAVS1 sgRNA spacer (AAVS1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-RPB1-N-term
Plasmid#195111PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-2-RPB1-C-term
Plasmid#195109PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 C-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against last exon of RPB1 (C-terminal)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA4-CTCF-3p-UTR
Plasmid#195106PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-CTCF-3p-UTR
Plasmid#195105PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-CTCF-prom
Plasmid#195104PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF promoter
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA1-CTCF-prom
Plasmid#195103PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF promoter
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ANLN_sgRNA
Plasmid#183876PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorInsertANLN sgRNA spacer (ANLN Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-RPB1-N-term
Plasmid#195112PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA1-RPB1-N-term
Plasmid#195110PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ACTB_sgRNA
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorInsertACTB sgRNA spacer (ACTB Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-TUBA1B_sgRNA
Plasmid#183888PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and TUBA1B sgRNA for N-terminal tagging of alpha-tubulin in human cells.DepositorInsertTUBA1B sgRNA spacer (TUBA1B Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only