We narrowed to 573 results for: CH1
-
Plasmid#199218PurposeLPUtopia-7 matching RMCE donor plasmid with Cas9-resistant GFP-BACH1 Negative-Feedback circuit (mNF-BACH1 Cas9- resistant). Use BlastR for positive selection and HSV-TK for negative selection.DepositorInserthTetR::P2A::EGFP::BACH1 (BACH1 Human)
TagsEGFPExpressionMammalianMutationsilient mutation at nucleic acid 177 C changed to…PromoterCMV D2ir promoterAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-CH111-QES.c13.L544Y-754*
Plasmid#123264PurposeMammalian expression plasmid for Env from the CH111 HIV-1 isolate; C-terminal truncation; QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (AD8) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCIneoRL-Notch1 3'UTR-mir200c-mut
Plasmid#84596PurposeRenilla Luciferase reporter assay for NOTCH1 3'UTR with mutations on miR-200c binding siteDepositorInsertNOTCH1 3'UTR (NOTCH1 Human)
UseLuciferaseTagsRenilla LuciferaseMutationMutation on miR-200c binding site on NOTCH1 3…PromoterCMVAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-Flex-MCS-WPRE-SV40 - GCH14
Plasmid#230821PurposeAAV cloning vector for CRE-dependent expression under the EF1a promoter.DepositorTypeEmpty backboneUseAAV and Cre/Lox; Cloning vectorAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FRT-MCS-WPRE-SV40 - GCH15
Plasmid#230822PurposeAAV cloning vector for Flpo-dependent expression under the EF1a promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
gWiz_BM40-vAchT-Cytosolic-VH-hIgG1-CH1-TS-HIS
Plasmid#218446Purposemammalian expression plasmid for the heavy chain fragment of an anti-vAchT Fab domain binding to the cytosolic side of the transporterDepositorInsertvAchT-Cytosolic-Vh-hIgG1-CH6
UseAffinity Reagent/ AntibodyTagsBM40 and TwinStrep-6xHisExpressionMammalianPromoterCMVAvailable SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FRT-MCS-WPRE-SV40 - GCH15.1
Plasmid#241328PurposeAAV cloning vector for Flp dependent expression under the EF1a promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Syn-FRT-MCSrev-WPRE-SV40 - GCH12.1
Plasmid#241333PurposeAAV cloning vector for Flp dependent expression under the Syn promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FRT-MCSrev-WPRE-SV40 - GCH18.1
Plasmid#241334PurposeAAV cloning vector for Flp dependent expression under the EF1a promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCh1753_S2F-IMCg_doxy-CMV_mChe-Cdc42E7-E63'UTR
Plasmid#118615Purposeexpression of mChe-tagged cdc42E7-E6-3'UTR (swap) under doxy-inducible CMV promoterDepositorInsertcdc42E7-E6 3'UTR (Cdc42 Mouse)
UseLentiviralTagsmCherryExpressionMammalianPromotertetON CMVAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH1(Trunc1)-COMP5AP-AviTag-9xHis
Plasmid#157612PurposeMammalian expression of cell-surface protein partial extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH1(Trunc1)-Fc(DAPA)-AviTag-6xHis
Plasmid#157048PurposeMammalian expression of cell-surface protein partial extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertNOTCH1 (NOTCH1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
p254-RV-CAG-dio-mScarlet-T2A-Dach1-202
Plasmid#204742PurposeConditional expression of target gene Dach1 with fluorescent reporter mScarletDepositorInsertDach1
UseRetroviralPromoterCAGAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgNotch1#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209068PurposeEntry vector that encodes sgRNAs against mouse Notch1, Rb1, Trp53, Rbl2, and CMV Cre recombinase.DepositorInsertsgRNAs targeting Notch1, Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH1(Trunc3)-COMP5AP-AviTag-9xHis
Plasmid#157566PurposeMammalian expression of cell-surface protein partial extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH1(Trunc2)-COMP5AP-AviTag-9xHis
Plasmid#157547PurposeMammalian expression of cell-surface protein partial extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH1(Trunc3)-Fc(DAPA)-AviTag-6xHis
Plasmid#157002PurposeMammalian expression of cell-surface protein partial extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertNOTCH1 (NOTCH1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH1(Trunc2)-Fc(DAPA)-AviTag-6xHis
Plasmid#156983PurposeMammalian expression of cell-surface protein partial extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertNOTCH1 (NOTCH1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Clone 16 - 3 HK02 pFUSE-IgG-human kappa VL-CH1 hole-clone2
Plasmid#192185PurposeClone 16 (HK02) pFUSE-IgG-human kappa VL-CH1 hole-clone2DepositorInsertClone 2 light chain (HK02)
ExpressionMammalianMutationNAAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRVL-2
Plasmid#104580PurposeContains mouse IgG2c CH1/CH2/CH3 domains, for cloning of antibody VH domains using SapI restriction enzyme. Full Fc-mediated immune effector functionsDepositorInsertMouse IgG2c CH1/CH2/CH3
ExpressionMammalianPromoterCMVAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRVL-5
Plasmid#104583PurposeContains human IgG1 CH1/CH2/CH3 domains, for cloning of antibody VH domains using SapI restriction enzyme. Full Fc-mediated immune effector functionsDepositorAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRVL-3
Plasmid#104581PurposeContains mouse IgG2c CH1/mutated CH2/CH3 domains, for cloning of antibody VH domains using SapI restriction enzyme. Abolished Fc-mediated immune effector functionsDepositorInsertMouse IgG2c CH1/CH2/CH3 (mutated, no effector functions)
ExpressionMammalianMutationL234A/L235E/G237A and E318A/K320A/K322APromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRVL-6
Plasmid#104584PurposeContains human IgG1 CH1/mutated CH2/CH3 domains, for cloning of antibody VH domains using SapI restriction enzyme. Abolished Fc-mediated immune effector functionsDepositorInsertHuman IgG1 CH1/CH2/CH3 (mutated, no effector functions) (IGHG1 Human)
ExpressionMammalianMutationL234A/L235E/G237A and K322A/P331SPromoterCMVAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM_M18
Plasmid#91729PurposeExpression plasmid coding for heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18.DepositorAvailable SinceJune 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Asp_M18
Plasmid#91781PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Asp (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Asp (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Ala_M18
Plasmid#91733PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Ala (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Ala (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Arg210Ala_M18
Plasmid#91734PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Arg210Ala (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationArg210 changed to Ala (EU numbering)PromoterhEF1-HTLV promAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Arg_M18
Plasmid#91740PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Arg (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Arg (EU numbering)PromoterhEF1-HTLV promAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Ile_M18
Plasmid#91746PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Ile (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Ile (EU numbering)PromoterhEF1-HTLV promAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Val_M18
Plasmid#91756PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Val (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Val (EU numbering)PromoterhEF1-HTLV promAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Tyr_M18
Plasmid#91755PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Tyr (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Tyr (EU numbering)PromoterhEF1-HTLV promAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Thr_M18
Plasmid#91753PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Thr (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Thr (EU numbering)PromoterhEF1-HTLV promAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Lys208Ala_M18
Plasmid#91732PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Lys208Ala (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationLys208 changed to Ala (EU numbering)PromoterhEF1-HTLV promAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Trp_M18
Plasmid#91754PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Trp (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Trp (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-chimeric-IgM-mouse/human_M18
Plasmid#91738PurposeExpression plasmid coding for modified heavy chain of mouse IgM antibody. Residues 203-239 (EU numbering) were exchanged to human homologue sequence.DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationResidues 203-239 (EU numbering) were exchanged to…PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Ser_M18
Plasmid#91752PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Ser (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Ser (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Pro_M18
Plasmid#91751PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Pro (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Pro (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Phe_M18
Plasmid#91750PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Phe (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Phe (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Met_M18
Plasmid#91749PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Met (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Met (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Lys_M18
Plasmid#91748PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Lys (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Lys (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Leu_M18
Plasmid#91747PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Leu (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Leu (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209His_M18
Plasmid#91745PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209His (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to His (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Gly_M18
Plasmid#91744PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Gly (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Gly (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Glu_M18
Plasmid#91743PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Glu (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Glu (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Gln_M18
Plasmid#91742PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Gln (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Gln (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Cys_M18
Plasmid#91741PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Cys (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Cys (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asp212Ser_M18
Plasmid#91739PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asp212Ser (EU numbering) - N-glycosylated Asn209DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsp212 changed to Ser (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only