We narrowed to 959 results for: Gatc
-
Plasmid#170127PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a GAC at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'GAC)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (3'GAC)
Plasmid#170129PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a GAC at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(3'GAC)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6AvailabilityAcademic Institutions and Nonprofits only -
pUDE735
Plasmid#103024Purposeexpression of a Cpf1 programming crRNA targetting CAN1, HIS4, PDR12 and ADE2 (crCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S)DepositorInsertcrCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S
UseCRISPRExpressionYeastPromoterSNR52Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-CDS
Plasmid#136045PurposeUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pY71-PT7-RiboJ-sfGFP-MGapt
Plasmid#129119PurposeExpresses a fluorescent reporter for the quantification of cell-free protein expression.DepositorInsertSuperfolder GFP with Malachite Green aptamer
UseSynthetic BiologyTagsHis6 and RiboJ InsulatorExpressionBacterialPromoterT7Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459_LIG4_Exon3
Plasmid#225363PurposepX459 plasmid encoding the sgRNA protospacer sequence “5’-GCATAATGTCACTACAGATC-3’ to target the LIG4 gene.DepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shSrpk3-2
Plasmid#180401PurposeProducing AAV that encodes mouse Srpk3 shRNA-2 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-irf3-shrna5
Plasmid#127649PurposeKnock-down of human IRF3DepositorInsertIRF3 shRNA (IRF3 Human)
UseLentiviralAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN1
Plasmid#52676PurposeshRNA against α-actinin-1 with eGFP transfection markerDepositorAvailable SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
shMEK1/2 v2 puro
Plasmid#72568PurposeHairpin targeting MEK1 and MEK2 (murine).DepositorAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAcUW51-gEgIL
Plasmid#11622DepositorInsertHSV-1 glycoprotein E and HSV-1 glycoprotein I
TagsHisExpressionInsectMutationDicistronic vector containing HSV-1 gE (KOS strai…Available SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shSmad2
Plasmid#37051DepositorAvailable SinceJan. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
shMEK1/2 v2 neo
Plasmid#72570PurposeHairpin targeting MEK1 and MEK2 (murine).DepositorAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN2
Plasmid#52677PurposeshRNA against α-actinin-2 with eGFP transfection markerDepositorAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTC362
Plasmid#91216Purposeprotoplast vector for targeted deletion of 6 genes in tomatoDepositorInsertgRNAs targeting 6 tomato genes
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
PRKCE gRNA (BRDN0001148049)
Plasmid#76791Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSuper DGK zeta human
Plasmid#224575PurposeTo downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only