We narrowed to 650 results for: atm
-
Plasmid#207082PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous ATM locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human ATM locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMVS102_P3-GFP-NATMX6
Plasmid#99048PurposeEGFP reporter with six binding sites for the Zif268 DNA binding domainDepositorInsertsMcIsaac 2014 P3 promoter
eGFP
clonNAT resistance
ExpressionYeastMutationGAL1 promoter with 4 GAL4 sites removed and repla…PromoterMcIsaac 2014 P3 promoterAvailable SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001149518)
Plasmid#77529Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001149033)
Plasmid#77531Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtTAS1c-D2-B/c-AtMIR173
Plasmid#137885PurposePlant expression vector for direct cloning of synthetic trans-acting siRNAs into Arabidopsis thaliana TAS1c precursor downstream 3'D1[+]. Contains AtMIR173 for syntasi expression in any plant species.DepositorInsertsAtTAS1c-D2-B/c
2x35S-AtMIR173-Tnos
ExpressionPlantMutationA. thaliana TAS1c precursor sequence including a …Available SinceMay 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001146099)
Plasmid#77530Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TagBFP2-C1-SACM1LdeltaTMD-Fis1tail
Plasmid#220078PurposeSAC1 with the TMD deleted and replaced with the Fis1tail to replace the TMD and target the mitochondria instead of the ER with a Blue FluorophoreDepositorAvailable SinceMay 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGFP-1-SAC1deltaTMD-Fis1tail
Plasmid#220077PurposeSAC1 with the TMD deleted and replaced with the Fis1tail to replace the TMD and target the mitochondria instead of the ER with a Green FluorophoreDepositorAvailable SinceMay 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAC1C389SdeltaTMD-FKBP-mCherry
Plasmid#108124PurposeRecruitable cytosolic inactive SAC1DepositorInsertSACM1L(C389S; 1-520):FKBP1A(3-108):mCherry (SACM1L Human)
ExpressionMammalianMutationSACM1L(C389S; 1-520)PromoterCMVAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pB-CAG-PE2-NatMX
Plasmid#158567PurposePiggybac vector that allows for the generation of PE2-expressing stable cell linesDepositorInsertPE2
UseCRISPRExpressionMammalianAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLIX403-ccdB-NatMx
Plasmid#158563PurposeSet of empty Gateway Cloning compatible, inducible, lentiviral vectors with various mammalian selection markers and N-terminal fluorescent protein fusionsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
YIp TRP1-NatMx
Plasmid#122924PurposeTRP1-NatMx integrating (YIp) vector for stable genomic integration in the BY4741 background.DepositorTypeEmpty backboneUseYeast recombination cloningExpressionYeastAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCfB9336 (pgRNA_II-1_NatMX)
Plasmid#161589PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site II-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 _3xHA-Ago2_CATmut
Plasmid#73540PurposeInducible lentiviral expression of Ago2_CATmutDepositorInsertAgo2 (Ago2 Mouse)
UseLentiviralTags3xHAExpressionMammalianMutationCatalytic mutant PIWI domain D670APromoterTRE promoter, Tet ONAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn PM-SYT7alpha deltaTMD
Plasmid#179720PurposeLentiviral expression of plasma membrane-targeted mouse Syt7DepositorInsertSYT7 (Syt7 Mouse)
UseLentiviralAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtMIR390a-NbSu-2
Plasmid#213400PurposePlant expression vector (2x35S) for expressing an amiRNA against Nicotiana benthamiana SULFUR gene from AtMIR390a precursorDepositorInsertArabidopsis MIR390a precursor including amiRNA/amiRNA* sequences for silencing N. benthamiana SULFUR gene
ExpressionPlantPromoter2x35SAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
p415PGK1-AtMAX1(pYL759)
Plasmid#178289PurposeExpresses MAX1 from A. thaliana (AtMAX1) in Saccharomyces cerevisiae. Centromeric LEU, PPGK1-AtMAX1-Tpho5DepositorInsertAtMAX1
ExpressionYeastPromoterPGK1Available SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAtm/Cre
Plasmid#89643PurposeExpresses an Atm-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB9337 (pgRNA_IV-1_NatMX)
Plasmid#161590PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IV-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only